ID: 937057622

View in Genome Browser
Species Human (GRCh38)
Location 2:118952733-118952755
Sequence TGCGGTGGCCTCAGGGGTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937057622_937057632 9 Left 937057622 2:118952733-118952755 CCCTTACCCCTGAGGCCACCGCA No data
Right 937057632 2:118952765-118952787 GTGGTGCCTCCTCATGAAAGAGG No data
937057622_937057636 29 Left 937057622 2:118952733-118952755 CCCTTACCCCTGAGGCCACCGCA No data
Right 937057636 2:118952785-118952807 AGGACTAGAGATGCCCCCGGAGG No data
937057622_937057635 26 Left 937057622 2:118952733-118952755 CCCTTACCCCTGAGGCCACCGCA No data
Right 937057635 2:118952782-118952804 AAGAGGACTAGAGATGCCCCCGG No data
937057622_937057629 -10 Left 937057622 2:118952733-118952755 CCCTTACCCCTGAGGCCACCGCA No data
Right 937057629 2:118952746-118952768 GGCCACCGCAAGAGGTGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937057622 Original CRISPR TGCGGTGGCCTCAGGGGTAA GGG (reversed) Intronic
No off target data available for this crispr