ID: 937057630

View in Genome Browser
Species Human (GRCh38)
Location 2:118952748-118952770
Sequence CACCACACCACCTCTTGCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937057630_937057632 -6 Left 937057630 2:118952748-118952770 CCACCGCAAGAGGTGGTGTGGTG No data
Right 937057632 2:118952765-118952787 GTGGTGCCTCCTCATGAAAGAGG No data
937057630_937057636 14 Left 937057630 2:118952748-118952770 CCACCGCAAGAGGTGGTGTGGTG No data
Right 937057636 2:118952785-118952807 AGGACTAGAGATGCCCCCGGAGG No data
937057630_937057635 11 Left 937057630 2:118952748-118952770 CCACCGCAAGAGGTGGTGTGGTG No data
Right 937057635 2:118952782-118952804 AAGAGGACTAGAGATGCCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937057630 Original CRISPR CACCACACCACCTCTTGCGG TGG (reversed) Intronic
No off target data available for this crispr