ID: 937057632

View in Genome Browser
Species Human (GRCh38)
Location 2:118952765-118952787
Sequence GTGGTGCCTCCTCATGAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937057622_937057632 9 Left 937057622 2:118952733-118952755 CCCTTACCCCTGAGGCCACCGCA No data
Right 937057632 2:118952765-118952787 GTGGTGCCTCCTCATGAAAGAGG No data
937057626_937057632 2 Left 937057626 2:118952740-118952762 CCCTGAGGCCACCGCAAGAGGTG No data
Right 937057632 2:118952765-118952787 GTGGTGCCTCCTCATGAAAGAGG No data
937057627_937057632 1 Left 937057627 2:118952741-118952763 CCTGAGGCCACCGCAAGAGGTGG No data
Right 937057632 2:118952765-118952787 GTGGTGCCTCCTCATGAAAGAGG No data
937057623_937057632 8 Left 937057623 2:118952734-118952756 CCTTACCCCTGAGGCCACCGCAA No data
Right 937057632 2:118952765-118952787 GTGGTGCCTCCTCATGAAAGAGG No data
937057631_937057632 -9 Left 937057631 2:118952751-118952773 CCGCAAGAGGTGGTGTGGTGCCT No data
Right 937057632 2:118952765-118952787 GTGGTGCCTCCTCATGAAAGAGG No data
937057625_937057632 3 Left 937057625 2:118952739-118952761 CCCCTGAGGCCACCGCAAGAGGT No data
Right 937057632 2:118952765-118952787 GTGGTGCCTCCTCATGAAAGAGG No data
937057630_937057632 -6 Left 937057630 2:118952748-118952770 CCACCGCAAGAGGTGGTGTGGTG No data
Right 937057632 2:118952765-118952787 GTGGTGCCTCCTCATGAAAGAGG No data
937057620_937057632 25 Left 937057620 2:118952717-118952739 CCAGGTGGGTCTTGGTCCCTTAC No data
Right 937057632 2:118952765-118952787 GTGGTGCCTCCTCATGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937057632 Original CRISPR GTGGTGCCTCCTCATGAAAG AGG Intronic
No off target data available for this crispr