ID: 937062719

View in Genome Browser
Species Human (GRCh38)
Location 2:118992342-118992364
Sequence ATGAGTGGGGAGCGGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 676
Summary {0: 1, 1: 1, 2: 5, 3: 48, 4: 621}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937062719_937062733 26 Left 937062719 2:118992342-118992364 CCCTCCACCCGCTCCCCACTCAT 0: 1
1: 1
2: 5
3: 48
4: 621
Right 937062733 2:118992391-118992413 TGGGTTTCTTTCAAACCGTGTGG 0: 1
1: 0
2: 0
3: 6
4: 91
937062719_937062734 27 Left 937062719 2:118992342-118992364 CCCTCCACCCGCTCCCCACTCAT 0: 1
1: 1
2: 5
3: 48
4: 621
Right 937062734 2:118992392-118992414 GGGTTTCTTTCAAACCGTGTGGG 0: 1
1: 0
2: 0
3: 2
4: 68
937062719_937062728 -6 Left 937062719 2:118992342-118992364 CCCTCCACCCGCTCCCCACTCAT 0: 1
1: 1
2: 5
3: 48
4: 621
Right 937062728 2:118992359-118992381 ACTCATGCAAATGCAGGCAAAGG 0: 1
1: 0
2: 1
3: 15
4: 236
937062719_937062730 7 Left 937062719 2:118992342-118992364 CCCTCCACCCGCTCCCCACTCAT 0: 1
1: 1
2: 5
3: 48
4: 621
Right 937062730 2:118992372-118992394 CAGGCAAAGGCGTCCTGCCTGGG 0: 1
1: 0
2: 0
3: 13
4: 141
937062719_937062729 6 Left 937062719 2:118992342-118992364 CCCTCCACCCGCTCCCCACTCAT 0: 1
1: 1
2: 5
3: 48
4: 621
Right 937062729 2:118992371-118992393 GCAGGCAAAGGCGTCCTGCCTGG 0: 1
1: 0
2: 0
3: 12
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937062719 Original CRISPR ATGAGTGGGGAGCGGGTGGA GGG (reversed) Intronic
900029296 1:359295-359317 AGGAGTGGGGAGGAGGAGGAGGG - Intergenic
900049898 1:588067-588089 AGGAGTGGGGAGGAGGAGGAGGG - Intergenic
900298778 1:1966190-1966212 ATGAGTGTGGAGAGGGAGGCGGG + Intronic
900601265 1:3503750-3503772 GGGGGTGGGGAGCGGGAGGAAGG + Intronic
901322543 1:8348565-8348587 CTCAGCGGGGAGCGGGTGGAGGG + Intergenic
901447177 1:9315704-9315726 CTGAGTGGGGAGTTGGTGGGGGG + Intronic
901714241 1:11140308-11140330 TTGGGTGGGGGGCGGGGGGATGG + Intronic
903227920 1:21904307-21904329 AAGAGTGCGGACCAGGTGGAGGG + Intronic
903455511 1:23484271-23484293 AGGAGCGGAGAGCGGCTGGAGGG - Intronic
903578432 1:24353501-24353523 ATGGGTGGGTAGATGGTGGATGG + Intronic
904037369 1:27566046-27566068 AAGATTGGGGAGCTGGTGCAGGG - Intronic
904336684 1:29802472-29802494 AGCTGTGGGGAGCGGGTGCAGGG + Intergenic
904625212 1:31798554-31798576 CTGAGTGAGGAGGTGGTGGAGGG - Exonic
905273032 1:36799451-36799473 CACAGTGGGGAGCGGGGGGAAGG - Exonic
906201613 1:43964021-43964043 AGGAGTGGGGAGTAGGCGGAAGG + Intronic
906954548 1:50361235-50361257 AAGAGTGGGGTGGGGGTGGGGGG + Intergenic
907268049 1:53274763-53274785 AAGAGTGGCAAGCGCGTGGACGG - Intronic
907285422 1:53376679-53376701 GTGAGTGGGGAGTGGTTGGGTGG - Intergenic
908325999 1:63024352-63024374 GTGTGTGGGGAGGGAGTGGAGGG + Intergenic
909535135 1:76727733-76727755 ATGAGTGTGGAGGCTGTGGAGGG - Intergenic
911767919 1:101701653-101701675 GGGAGTGGGGAGGGGGGGGAGGG - Intergenic
911794996 1:102064414-102064436 AAGAGTGGGTGGCGGGAGGAGGG + Intergenic
912529193 1:110307880-110307902 AGGAGTGGGGAGGGGGTGACTGG - Intergenic
913220155 1:116653632-116653654 CTGGGTGGGTAGAGGGTGGAAGG - Intronic
915091376 1:153428659-153428681 ATGTGTGGGCAGAGGGAGGAGGG + Intergenic
915360463 1:155283547-155283569 ATGGGTGGGGGGAGGGGGGAGGG - Intronic
915479141 1:156173290-156173312 ATGAAAGGTGAGTGGGTGGAGGG + Intronic
915572415 1:156751718-156751740 AGGAGTGGGGACCGGGCGGGGGG - Intronic
915635771 1:157185520-157185542 GTGTGTGGTGAGCAGGTGGAAGG - Intergenic
915875681 1:159609742-159609764 CGGAGTGGGGGGAGGGTGGAGGG + Intergenic
915878822 1:159643460-159643482 AGGGGAGGGGAGCGGGGGGAGGG + Intergenic
915932324 1:160068353-160068375 CTGAGTGGGGGGTGGGGGGATGG + Intronic
916031926 1:160884552-160884574 AGGAGTGGGCAGTGGCTGGAAGG + Intronic
919763383 1:201112032-201112054 TTGAGTGAGGAGCTGGGGGAAGG - Intronic
919850399 1:201668443-201668465 AGGAGTGATGAGCGAGTGGATGG - Intronic
919980088 1:202637568-202637590 AGCAGTGGGGAGCAGGTTGAAGG + Intronic
920388090 1:205581983-205582005 ATGAGGGGGCAGCAGGTAGATGG - Intronic
922091817 1:222402822-222402844 CTGAGTGGGGAGGTGGTGGCTGG - Intergenic
922576880 1:226666729-226666751 ATGAGTGGAGAGTGGGTTGCAGG - Intronic
923194948 1:231656776-231656798 ATCAGTGGGCAGTGGGTGGGAGG - Intronic
923300492 1:232635719-232635741 ATGAATAGGGAGTGGGTGGATGG + Intergenic
924246929 1:242094282-242094304 ACAAGGGGGTAGCGGGTGGATGG - Intronic
924802026 1:247334673-247334695 TTGAGTGGAGAGCAGGTGGGGGG + Intergenic
1063023462 10:2154148-2154170 ATGAATGGGCAGCAGGTGGTGGG + Intergenic
1063749756 10:8930066-8930088 AAGGGTGTGGAGTGGGTGGAGGG + Intergenic
1064166703 10:12992872-12992894 ATTTGTGGGGACTGGGTGGATGG + Intronic
1067741231 10:48897354-48897376 ATGTGGGTGGAGCTGGTGGAGGG + Intronic
1067833695 10:49624892-49624914 ATGAGTGGGTGGTGGGTGGAAGG + Intronic
1067895859 10:50178693-50178715 TGGGGTGGGGAGAGGGTGGAGGG - Intergenic
1067983675 10:51116744-51116766 ATGATGGGAGAGAGGGTGGAAGG + Intronic
1068382935 10:56282358-56282380 ATCAGAGGGCAGAGGGTGGAAGG - Intergenic
1069135037 10:64753393-64753415 ATGAGTGGGGAGAGGCAGGATGG - Intergenic
1069746016 10:70715514-70715536 ATGATGGGGGTGAGGGTGGAGGG + Intronic
1069827050 10:71260799-71260821 ATGAGTGGGCAGTGGGTGGCTGG + Intronic
1069871369 10:71535186-71535208 ACTGGTTGGGAGCGGGTGGATGG + Intronic
1070004383 10:72409073-72409095 ATGTGTGGGAAGCGGGGGAAAGG - Intronic
1072639584 10:97201871-97201893 AAGAGGAGGGAGCAGGTGGAGGG - Intronic
1073432357 10:103494500-103494522 AGGACTGGGGCGCAGGTGGAGGG + Intronic
1073438664 10:103538593-103538615 ATCAGTGGGTAGCAGGTGGTTGG - Intronic
1074894472 10:117763012-117763034 AGGATTGGGGAGAGGGTGAAAGG + Intergenic
1075201029 10:120404321-120404343 ATGAATGGGTAGCAAGTGGATGG + Intergenic
1076073929 10:127517042-127517064 ATGAGAGGGGGGCTGGTGGAGGG + Intergenic
1076482064 10:130791430-130791452 GTGTGTGGGGAGCGTGTGGTAGG - Intergenic
1076579278 10:131495997-131496019 ATGAGTGTGGATGGGGTGGGGGG - Intergenic
1076673165 10:132134108-132134130 ATGAGTGCGGAGCGGCAGCAAGG - Intronic
1076897496 10:133320067-133320089 CTGAGTGGGGAGTGGGGGGTGGG - Intronic
1077015139 11:395995-396017 GTGGGTGGGCAGAGGGTGGAGGG - Intronic
1077318301 11:1928918-1928940 ATGCCTGGGGAGGGGGTGGAAGG - Intronic
1077357509 11:2125436-2125458 ATGACTGGGGGGTGGATGGAGGG + Intergenic
1077357526 11:2125525-2125547 ATGACTGGGGGGTGGATGGAGGG + Intergenic
1077357812 11:2126855-2126877 GTGAGTGGTAAGTGGGTGGATGG + Intergenic
1078050777 11:7963184-7963206 GTGAGTGTGGAGCGGGGGAAGGG - Intronic
1078069941 11:8101803-8101825 AGTAGTGGAGAGCGGGTGGGTGG + Exonic
1078679817 11:13464969-13464991 AGGAGTGGGGCGGGGGTGGGGGG - Intergenic
1081914267 11:46720645-46720667 AGGAGTGGGGAAGGGGTGGATGG - Intronic
1082097556 11:48143784-48143806 AGGAGAGGGGAGGGGGAGGAGGG - Intronic
1082600117 11:55138686-55138708 TGGAGTGGGGAGAGGGTGGAGGG + Intergenic
1083032106 11:59602477-59602499 GTTAGTGGGGAGCCAGTGGAGGG - Intronic
1083331136 11:61898932-61898954 CTGTGGGGGGAGGGGGTGGAGGG + Intronic
1084430218 11:69106796-69106818 CTGAGTGGGAAGATGGTGGAGGG - Intergenic
1084460917 11:69296163-69296185 AGGGGTGGGGTGCCGGTGGAGGG - Exonic
1084754211 11:71224532-71224554 TTGGGTGGGAAGAGGGTGGATGG - Intronic
1084812823 11:71625336-71625358 AGGAATGGAGAGCGGGTGAATGG + Intergenic
1085749842 11:79152084-79152106 AGGAGTGGAGAGAGGATGGAAGG - Intronic
1085887505 11:80537461-80537483 ATGAGAGAAGAGCGGGAGGAGGG + Intergenic
1086871676 11:92044904-92044926 GGGAGTGGGGGGCGGGAGGAGGG + Intergenic
1088871835 11:113896980-113897002 CTGAGTGGGGAGAGGGTGAACGG - Intergenic
1090409906 11:126501014-126501036 ATGTCTCGGCAGCGGGTGGAGGG - Intronic
1091648157 12:2289336-2289358 CTGCCTGGGGAGGGGGTGGATGG + Intronic
1091670150 12:2446749-2446771 ATGAGTAGTGAGTGGGTGGGTGG + Intronic
1091755431 12:3048199-3048221 ATGAGCGGGGTGAGGGTGGCTGG + Intergenic
1092021388 12:5205497-5205519 ATGAGAGGGCAGCTGCTGGAGGG + Intergenic
1092393629 12:8104721-8104743 CTGAGTGGGGAGGGGGAGAAGGG - Intergenic
1093020408 12:14198288-14198310 AGGGGTGGGGAGTGGGGGGAGGG - Intergenic
1093081548 12:14817471-14817493 AGGAGTGGGGGGCGAGGGGAGGG - Intronic
1093642306 12:21541849-21541871 TTGAGTGGGGAGTGGGGGAAGGG - Intronic
1093798100 12:23337597-23337619 ATGAGTGGGGGGAGGGTACACGG + Intergenic
1094291478 12:28855411-28855433 ATGAGTGGGGAGTGTTTGGGAGG - Intergenic
1096148164 12:49293416-49293438 GGGAGTGGGAAGCGGGAGGAAGG - Intronic
1096159928 12:49367640-49367662 AGGTGCGGGGAGCGGGTTGAGGG + Intronic
1096418013 12:51430483-51430505 ATGTGTGAGGAGAGGGTGGAGGG - Intronic
1096470334 12:51871592-51871614 CAGAGTGGGGGGCTGGTGGAGGG + Intergenic
1096613153 12:52816159-52816181 GTAAGTGGAGAGGGGGTGGAGGG + Intergenic
1096911271 12:54986757-54986779 ATGGGAGGGTAGAGGGTGGAAGG - Intergenic
1097196071 12:57243082-57243104 AGGGATGGGGAGGGGGTGGAGGG - Intergenic
1097294683 12:57949857-57949879 TTGAGTGGGGAGATGGGGGATGG - Intronic
1097338824 12:58414731-58414753 GTGGGTGGGGAGTGGGTGGGGGG + Intergenic
1097741375 12:63246375-63246397 TGGAGTGGGGAGAGGGGGGAGGG + Intergenic
1099034178 12:77564848-77564870 TTGAGTGGGGAGGAGGTGAAAGG - Intergenic
1101997581 12:109535942-109535964 ATGAGGTGGGAGAGGGTGGGTGG - Exonic
1102390461 12:112545172-112545194 ATGAGGGGGGTGCGGCTGCAAGG - Intergenic
1102467027 12:113135851-113135873 ATGACTGGGGTGCCGGTAGAGGG - Intronic
1102531736 12:113551683-113551705 ATGAGTGGTGAGAGAGTGGGTGG - Intergenic
1102657029 12:114490669-114490691 GGGACTGGGGAGCGGGGGGAGGG + Intergenic
1102717479 12:114986639-114986661 ATGAGTGGGGAGAGAAGGGAAGG - Intergenic
1103215085 12:119195561-119195583 ATGTGGGGGGAGCTGGGGGAGGG + Intronic
1104081416 12:125433661-125433683 ATGGGTGGGGGGAGGGGGGAGGG - Intronic
1104300362 12:127559438-127559460 CTGTGTGGGGAGTGGGAGGAGGG + Intergenic
1104476869 12:129078073-129078095 CTGAGTGGGGAGCCTGTGGCGGG - Intronic
1104565107 12:129873914-129873936 ATGAATGGGGAGTTAGTGGAAGG - Intronic
1104729026 12:131094933-131094955 AGGAGACGGGAGGGGGTGGAAGG - Intronic
1104844531 12:131840245-131840267 TTCAGTGGGGAGCAGGGGGATGG + Intronic
1104906737 12:132217569-132217591 ATGAGTGGGGGATGGCTGGATGG - Intronic
1104906820 12:132217935-132217957 ATGAGTGGTGAGTGGGTGGGTGG - Intronic
1105592140 13:21802255-21802277 ATGAGTGGAGTGCAGATGGATGG + Intergenic
1105920514 13:24958955-24958977 CAGAGTGGGGAGGGGGTGGCAGG + Intergenic
1105925044 13:25000406-25000428 ATGTGTGGGGAGTGGGAGAACGG + Intergenic
1106039562 13:26076625-26076647 ATGTGTGGGGAGTGGGAGAATGG - Intergenic
1106553101 13:30788314-30788336 ATGAGTAGGGAGTGGGCGGAAGG + Intergenic
1107835534 13:44409835-44409857 AGCAGTGGGGAAAGGGTGGAGGG + Intergenic
1107989589 13:45806562-45806584 ATGAGAGTGGGGAGGGTGGAAGG + Intronic
1108136311 13:47366351-47366373 AGGGGTGGGGAGCTAGTGGAGGG - Intergenic
1108640728 13:52380324-52380346 AAGAGTGGGCAGTGGGAGGACGG - Intronic
1109150043 13:58835738-58835760 AGGAGTGGGGAGCAGAGGGAGGG - Intergenic
1109237618 13:59843948-59843970 ATGAGTGGCGGGCAGGAGGAGGG + Intronic
1109248881 13:59993803-59993825 ATGACTGGCAAGGGGGTGGAAGG - Intronic
1110614462 13:77525832-77525854 ATGAGGTGGAAGGGGGTGGATGG + Intergenic
1110705698 13:78601141-78601163 GGGAGTGGGGAGTGGGGGGAAGG - Exonic
1111304406 13:86388200-86388222 TGGAGTGGGGAGAGGGGGGAGGG + Intergenic
1112152486 13:96779169-96779191 ATGAGTGGGGGGCTAGGGGAGGG + Intronic
1112441355 13:99426936-99426958 AGGAGGGAGGAGAGGGTGGAAGG + Intergenic
1112441394 13:99427037-99427059 AGGAGGGAGGAGAGGGTGGAAGG + Intergenic
1113298954 13:108995580-108995602 TGGAGTGGGGAGAGGGGGGAGGG - Intronic
1113487935 13:110668640-110668662 AGGAGTGGGGAGGGGATGGGAGG + Intronic
1113971518 13:114195040-114195062 ATGTGTGGGGCGGGGGTGAAGGG - Intergenic
1114512645 14:23275556-23275578 CTGAGTGGGGAGCTGGGGGAGGG - Exonic
1114661001 14:24344816-24344838 CTGAGTCGGCAGGGGGTGGAAGG - Intergenic
1115206601 14:30913040-30913062 AGGATTGGGGAGTGGATGGAAGG - Intronic
1117688526 14:58280527-58280549 AAGAGTGGGGGGTGGGGGGAAGG + Intronic
1118280117 14:64420643-64420665 CTGAGTGGGAAGCAGCTGGAGGG - Intronic
1118778994 14:68993713-68993735 ATGGCTGGGGAGTGGGTGGTGGG - Intergenic
1119430199 14:74562322-74562344 ATTAGAGGGGAGAGGGGGGAAGG + Intronic
1119601611 14:75980625-75980647 ATGCATGGGGAGAGGGAGGAAGG - Exonic
1119930017 14:78536748-78536770 ATGGGTGGGGGGCTGGGGGAGGG - Intronic
1120179883 14:81332119-81332141 ATGGCTGGGGAGCGGTGGGAAGG + Intronic
1121453720 14:94025600-94025622 AAGAGTGGGGCGCGGGGGGCGGG + Intergenic
1121608507 14:95259342-95259364 GTGAGTGGGGAGCCAGTGGACGG - Intronic
1121950413 14:98166762-98166784 ATGCGTGGGGACCTGTTGGATGG + Intergenic
1122264329 14:100539652-100539674 ATGGGTGGGGTGGGGGTGGCGGG - Intronic
1122923785 14:104890714-104890736 ATGAGTGGTGGGTGGATGGATGG + Intronic
1123703149 15:22930932-22930954 GTGAGTGGCGAGCGAGTGGGAGG - Intronic
1123706570 15:22955269-22955291 ATGAGTGGAGGGAGGCTGGATGG + Intronic
1123819160 15:24010332-24010354 TTGAGTGGGGGGAGGGGGGACGG - Intergenic
1123987942 15:25661534-25661556 AGGTGTGGGGGGCTGGTGGATGG - Intergenic
1124495701 15:30185613-30185635 AGCAGTGGGGAGCAGGTTGAAGG + Intergenic
1124699412 15:31899396-31899418 ATGGGTGGGGAGCAAGGGGAGGG + Intergenic
1124747872 15:32353033-32353055 AGCAGTGGGGAGCAGGTTGAAGG - Intergenic
1125993899 15:44137441-44137463 GTCAGTGGGGAGAGGGTGGTAGG - Intronic
1126541215 15:49826285-49826307 AGGAGTGGGGGGCTGGGGGAAGG - Intergenic
1126800056 15:52289943-52289965 ATGGGTGGGGCTAGGGTGGAAGG - Intronic
1127003522 15:54538845-54538867 AAGAGTGGAGGGCGGGAGGAGGG + Intronic
1127282122 15:57501593-57501615 AGAAGTGGGGAGCAGGAGGAGGG + Intronic
1127324725 15:57883956-57883978 ATGTGTGGGGAGTGGGAGGCAGG - Intergenic
1128151726 15:65367377-65367399 AGGAATGGGGAGAGGGGGGAGGG + Intronic
1128241016 15:66100984-66101006 GTGAGTGGGTGGTGGGTGGATGG + Intronic
1128781402 15:70361205-70361227 ATGAGTGGAAGGCAGGTGGAAGG - Intergenic
1128888797 15:71312339-71312361 TGGAGTGGGGAGTGGGGGGAGGG + Intronic
1128994928 15:72289081-72289103 TGGAGTGGGGAGCGGGGGGTGGG - Intronic
1129450320 15:75647837-75647859 AGGGGTGGGGAGAGGGAGGAGGG - Intronic
1129712186 15:77826042-77826064 GTGAGTGGGGTGGGGCTGGAGGG + Intergenic
1130166791 15:81469549-81469571 AGGATTTGGGAGAGGGTGGAAGG - Intergenic
1130677839 15:85969453-85969475 ATGTGTGAGGAAGGGGTGGATGG - Intergenic
1130850543 15:87789409-87789431 GTGAGTGGGGGGAGGGGGGAGGG + Intergenic
1130913359 15:88285912-88285934 ATGAGTGAGTAGGTGGTGGATGG - Intergenic
1131063178 15:89416932-89416954 AAGGGTGGGGTGCGGGGGGATGG - Intergenic
1131461336 15:92619667-92619689 CTGTGTGGGGAGCTGGGGGAGGG - Intronic
1131562294 15:93455131-93455153 ATGAGTGGGAAGGGGGTGGCTGG + Intergenic
1131809759 15:96160694-96160716 AAAACTTGGGAGCGGGTGGAAGG + Intergenic
1132019091 15:98344924-98344946 ATGGGTGGGAGGTGGGTGGATGG + Intergenic
1132688045 16:1170453-1170475 AGGGGAGGGGAGCGGGTGGACGG + Intronic
1133035640 16:3032608-3032630 AGGAGTGGGGTGGGGGTGGAGGG + Intronic
1133074020 16:3265573-3265595 ATTAGTTGGGAGAGGGGGGAGGG - Intronic
1133392816 16:5422976-5422998 AGGAGTGGGGAGAGGGAGGAGGG + Intergenic
1133392837 16:5423036-5423058 AGGAGTGGGGAGAGGGAAGAGGG + Intergenic
1134105888 16:11485800-11485822 ATGACTGGTGAGTGGATGGATGG + Intronic
1134112431 16:11523953-11523975 AGGAGAGGGGAGCGGGTGGGTGG - Intergenic
1134998827 16:18759807-18759829 GTGAGTGGAGAGTAGGTGGATGG + Intergenic
1135513679 16:23111338-23111360 ATGAATGTGGAGAGGGAGGAAGG + Intronic
1135651126 16:24207819-24207841 ATGAGTGGAGAAGGAGTGGAAGG + Intronic
1136009939 16:27356898-27356920 ATGAGTGGCGAGTGGCTGGGAGG + Intronic
1137940378 16:52677862-52677884 ATGAGTGGGGGACTGGAGGATGG - Intergenic
1138563081 16:57813701-57813723 ATGAGTGGTGCCCGGGTGCAGGG - Intronic
1139442730 16:66976946-66976968 AAGGGTGGGGAGCGGGGGAAGGG + Intergenic
1140116984 16:72050579-72050601 ATGAGGTGGGAGGGGGAGGAGGG + Intronic
1140972386 16:80025666-80025688 AAGGGTGGGGAGAGGATGGAAGG + Intergenic
1141096813 16:81168623-81168645 ATGAATGGTGGGGGGGTGGATGG + Intergenic
1141184870 16:81779690-81779712 TTGAATGGGGACCGGGAGGAAGG + Intronic
1141662487 16:85448970-85448992 GTGAGGGCTGAGCGGGTGGAGGG - Intergenic
1141667773 16:85474704-85474726 GGGAGTGGGGAGAGGGAGGAGGG - Intergenic
1142114986 16:88351801-88351823 AAGGGTGGGGAGAGGGTGGTGGG - Intergenic
1142128284 16:88420929-88420951 GTGAGTGGGGGTCGGGAGGAAGG + Intergenic
1142350500 16:89577184-89577206 CTGAGTGGGGAGGGGGCGTAGGG - Intronic
1142390811 16:89798607-89798629 AGGAGTGGGGGCTGGGTGGAAGG - Intronic
1142750936 17:1987190-1987212 ATGGGTGGAGAGCTGGGGGAGGG - Intronic
1143007316 17:3845723-3845745 GTGAGTGAGGAGGGGCTGGAAGG - Intronic
1143476050 17:7204574-7204596 AAGAGTGGGGAGAGGGGGGTAGG + Intronic
1143885245 17:10060324-10060346 ATGAGCTGGGAGTGGGAGGAGGG + Intronic
1144966094 17:19078083-19078105 GTGGATGGGGAGTGGGTGGATGG + Intergenic
1144966195 17:19078364-19078386 GTGGGTGGGGACTGGGTGGATGG + Intergenic
1144981723 17:19173693-19173715 GTGGGTGGGGACTGGGTGGATGG - Intergenic
1144981769 17:19173811-19173833 GTGGGTGGGGACTGGGTGGATGG - Intergenic
1144981874 17:19174106-19174128 GTGGATGGGGAGTGGGTGGATGG - Intergenic
1144986349 17:19204133-19204155 GTGGATGGGGAGTGGGTGGATGG + Intergenic
1144986455 17:19204428-19204450 GTGGGTGGGGACTGGGTGGATGG + Intergenic
1144986501 17:19204546-19204568 GTGGGTGGGGACTGGGTGGATGG + Intergenic
1145232744 17:21186471-21186493 ATGAGTTGGCTGTGGGTGGATGG - Intronic
1146820549 17:35980948-35980970 ATGAGTGGCGAGAGGAAGGAAGG - Intronic
1146824052 17:36008291-36008313 ATGAATGGGGAGCTGGAGAATGG - Intergenic
1147353228 17:39868415-39868437 AGGCCTGGGGACCGGGTGGAGGG - Intronic
1147418363 17:40309525-40309547 AAGAGTGGGGAGTAGGGGGAAGG + Intronic
1147562580 17:41518289-41518311 AAGAGAGGGGAGCAGGTGGCTGG - Intronic
1147967219 17:44199769-44199791 TGGAGTGGGGGGCGGGGGGAGGG - Intronic
1148146904 17:45371789-45371811 ATCGGCGGGGAGCGGGTGGGCGG - Intergenic
1148194266 17:45701909-45701931 AAGAGTGGGCAGAGTGTGGAAGG + Intergenic
1148472941 17:47906857-47906879 ATGAGTTGGCAGCCTGTGGAAGG + Intronic
1148879335 17:50713778-50713800 ATCAGTGTGTAGCAGGTGGAGGG + Intergenic
1149442657 17:56688009-56688031 ATTAGTGGACAGAGGGTGGATGG + Intergenic
1150152033 17:62817859-62817881 GATAGTGGGGAGGGGGTGGAAGG + Intergenic
1150644845 17:66971594-66971616 GCGTGTGGGGAGCGGCTGGAGGG + Intronic
1151386433 17:73757925-73757947 AAGAGAGGGGAGGGGATGGAAGG - Intergenic
1152263879 17:79282185-79282207 ATGGGTGGGGAGGTGGTGGAAGG + Intronic
1152330247 17:79668673-79668695 ATCAGAGGGGAGGAGGTGGAGGG - Intergenic
1152332597 17:79681736-79681758 AGGAGTGGGGAGAGAGAGGAAGG + Intergenic
1152607656 17:81301068-81301090 ATGTGTGTGGTGTGGGTGGATGG + Intergenic
1152795607 17:82304654-82304676 AGGGGTGGGGAGCAGGGGGAGGG - Intergenic
1152950462 17:83227261-83227283 AGGAGTGGGGAGGAGGAGGAGGG + Intergenic
1153475522 18:5494651-5494673 TTGGGTGGGGGGAGGGTGGATGG - Intronic
1155045562 18:22100189-22100211 ATGAGGGGAGAGAGGCTGGAGGG + Intergenic
1155292831 18:24358461-24358483 ATGAGTGGGCAGCAGGTTTATGG - Intronic
1155582971 18:27332569-27332591 ATGGGTGGGGAGAAGGCGGATGG - Intergenic
1157025836 18:43841469-43841491 TGGAGTGGGGAGCTGGGGGAGGG + Intergenic
1157249157 18:46078945-46078967 ATGAATGGGGGGAGGGGGGAGGG + Intergenic
1157570036 18:48706125-48706147 ATGAGAGAGGGACGGGTGGAGGG - Intronic
1157619333 18:49007061-49007083 CTGAGAGAGGAGTGGGTGGAAGG - Intergenic
1157676011 18:49569197-49569219 AAGTGTGGGGACAGGGTGGAGGG - Intronic
1157743917 18:50118142-50118164 TTTAGTTGGGGGCGGGTGGATGG - Intronic
1157822818 18:50786309-50786331 AGGACTGGGGGGAGGGTGGATGG - Intergenic
1158049636 18:53201122-53201144 ATGAGTGGGTATCTGGGGGAAGG - Intronic
1158308973 18:56138752-56138774 ATGAGTGGGAAGGGAGTGGGAGG + Intergenic
1158828044 18:61246537-61246559 ATGAGTGGATAGTAGGTGGATGG + Intergenic
1159122307 18:64185094-64185116 ATGGGTGGGGAGAGGGTTGGGGG + Intergenic
1159170109 18:64755554-64755576 ATGAGAGGGCAGCCGGTGCAGGG - Intergenic
1159995433 18:74960215-74960237 CTGAGTGTGGACTGGGTGGAGGG + Intronic
1159995470 18:74960395-74960417 CTGAGTGAGGACTGGGTGGAGGG + Intronic
1159995507 18:74960575-74960597 CTGAGTGTGGACTGGGTGGAGGG + Intronic
1159995539 18:74960719-74960741 CTGAGTGTGGACTGGGTGGAGGG + Intronic
1159995585 18:74960935-74960957 CTGAGTGAGGACTGGGTGGAGGG + Intronic
1159995593 18:74960971-74960993 CTGAGTGAGGACTGGGTGGAGGG + Intronic
1159995602 18:74961007-74961029 CTGAGTGAGGACTGGGTGGAGGG + Intronic
1159995611 18:74961043-74961065 CTGAGTGAGGACTGGGTGGAGGG + Intronic
1160140495 18:76317586-76317608 ATGAGTGGGGAGGGTGCAGAGGG + Intergenic
1160224404 18:77001158-77001180 ATGAGTGGGAACCGGGTGGGCGG - Intronic
1160391641 18:78538658-78538680 ATCAGTGGGGAACTGGAGGAGGG - Intergenic
1160392649 18:78546907-78546929 ATGGGGGAGGAGAGGGTGGAGGG + Intergenic
1160767855 19:816399-816421 ATGGGTGGAGAATGGGTGGATGG - Intronic
1160767944 19:816769-816791 ATGGGTGGAGAATGGGTGGATGG - Intronic
1160811834 19:1016193-1016215 ATGAGGGGTGGGCGGGGGGAGGG + Intronic
1160888058 19:1361268-1361290 GTGAGTGGGGAGCCCGTAGAGGG + Intronic
1160977773 19:1802246-1802268 ATGAGTGGGGGGTGGGTGGATGG - Intronic
1161001232 19:1912289-1912311 CTGGGCGGGGAGCGGGTGCAGGG - Exonic
1161287825 19:3477863-3477885 ATGAGTGGGTGATGGGTGGATGG + Intronic
1161347764 19:3776673-3776695 ATGAGTGGATGGTGGGTGGATGG + Intergenic
1161347775 19:3776716-3776738 ATGAGTGGATAGTGGGTAGATGG + Intergenic
1161347787 19:3776770-3776792 ATGAGTGGATAGTGGGTGGGTGG + Intergenic
1161403041 19:4077365-4077387 GTGATTGGGGAGGGGGTGGGTGG + Intergenic
1161641070 19:5423732-5423754 AGGGGTGGTGAGTGGGTGGATGG - Intergenic
1161657502 19:5525117-5525139 ATGGGTGGGTGGTGGGTGGATGG - Intergenic
1162062736 19:8106814-8106836 GGGAGTAGGGAACGGGTGGATGG + Intronic
1162781492 19:13009296-13009318 ATGCCTGGGCAGCGGGTGGGTGG + Intronic
1162784196 19:13023948-13023970 GTGAGTTGGGGGCGGGTGGGGGG - Intronic
1162792770 19:13071671-13071693 TTAAGTGGGGATGGGGTGGAGGG + Intronic
1163290848 19:16378101-16378123 ATGAATGGCGGGTGGGTGGATGG + Intronic
1163609862 19:18295226-18295248 ATGAATGGGTAGATGGTGGATGG - Intergenic
1163664595 19:18597394-18597416 GTGAGTGGGGAGGGGGTGGCAGG - Intronic
1164418532 19:28067054-28067076 AGGAGTGGGGTGCTGGTAGAAGG + Intergenic
1164540450 19:29118049-29118071 ATGAGTCGGGGGTGGGTAGATGG - Intergenic
1164711722 19:30361703-30361725 AAGAGTGGGGACCAGGTGGGTGG + Intronic
1164752798 19:30668978-30669000 CTGAGTGGGCAGCGGGGGCAAGG + Intronic
1164774998 19:30845967-30845989 CTGACTGGGTAGGGGGTGGATGG + Intergenic
1165475597 19:36028665-36028687 ATGGGTTGGGAGCTGGAGGAGGG - Intronic
1165478435 19:36046429-36046451 ACCAGTGGGGAGGAGGTGGATGG + Intronic
1165906203 19:39196361-39196383 CAGAGTGGGGAGGGGGAGGAGGG + Intergenic
1166288895 19:41849145-41849167 ATGAGTGGGCAGCTGGAGGGAGG - Exonic
1166665655 19:44678741-44678763 GAGAGGGGGGAGGGGGTGGAAGG - Intronic
1166678037 19:44751154-44751176 AGAAGTGGGGGGCGGGTTGAGGG + Intronic
1166760926 19:45224165-45224187 AGGAGTGGGGGGAGGGTGGCGGG + Intronic
1167199843 19:48056981-48057003 TTGGGTGGAGAGCGGGAGGAAGG + Intronic
1167216848 19:48170715-48170737 GTGAGTGGGGAGGGGCGGGAAGG + Intronic
1167426379 19:49431750-49431772 ATGAGTGGGGATTGAGGGGAAGG - Intronic
1167461264 19:49625789-49625811 AGGAATGGGGAGGGAGTGGAGGG - Exonic
1167596467 19:50430915-50430937 ATGAGTGGGAAGGGGGAGGGAGG + Exonic
1167600392 19:50451429-50451451 ATGAGTGGGGAGAGGAAGGAGGG + Intronic
1167669418 19:50841242-50841264 AGGAGGGTGGGGCGGGTGGAGGG + Intergenic
1168359058 19:55722996-55723018 GTGGGTGGGGAGCTGGGGGAGGG + Intronic
1168497969 19:56870007-56870029 GTGTGTGTGGAACGGGTGGAAGG - Intergenic
925759372 2:7169487-7169509 ATGAGTCGGGAGTGGGTTCAGGG - Intergenic
926309722 2:11666788-11666810 ATGAGTGAGGAGAGGAGGGAGGG + Intronic
926710787 2:15878330-15878352 GTGGGTGGGGAGCTGGGGGAGGG + Intergenic
927543493 2:23932533-23932555 AAGAGTGGGGAGCGGTGGGTGGG + Intronic
928132720 2:28664762-28664784 ATCCGAGGGGAGTGGGTGGATGG - Intergenic
928886191 2:36151252-36151274 CTGGGTGGGGAGTGGGTGTAGGG + Intergenic
929761524 2:44811200-44811222 TTGAGTGGGAAGTGGGTGGCGGG - Intergenic
929960661 2:46493935-46493957 ATGAGGCGGGAGAGGGTGGCGGG + Intronic
930027972 2:47041078-47041100 CTGACTGGGGTGGGGGTGGAGGG - Intronic
930063243 2:47308462-47308484 ATGAGTCAGGAGCTGGTGGAGGG - Intergenic
930710321 2:54544917-54544939 GGGAGTGGGGGGCTGGTGGAGGG - Intronic
931006114 2:57850923-57850945 AGGAGTGGGGTGCAGGTGGCAGG - Intergenic
932182644 2:69662433-69662455 CTGAGTGGGGAGGGGTGGGAGGG + Intronic
932190545 2:69738510-69738532 CTGAGTGGGGAGGGGTGGGAGGG - Intronic
932324477 2:70848162-70848184 GGGAGTGGGGAGCTGGGGGAGGG + Intergenic
933115869 2:78470498-78470520 GGGGGTGGGGAGTGGGTGGAAGG - Intergenic
933304240 2:80577483-80577505 ATGAGTTGGGAGCCACTGGAGGG + Intronic
933325499 2:80831567-80831589 TTGATTGGGGAGCGGGGGGTGGG - Intergenic
934774129 2:96926567-96926589 ATGAATGGGAAGCGGGTGGTGGG - Intronic
935035303 2:99365843-99365865 ATGAGTGGGCTGTGGGTGGGGGG - Intronic
935517597 2:104061497-104061519 ATGGGTGGGGGGAGGGGGGAGGG - Intergenic
935874385 2:107490118-107490140 GTGAGTGGGGAAGGGGAGGAAGG + Intergenic
936049715 2:109213727-109213749 TTGAGTGGGGAACGTGGGGATGG + Intronic
937062719 2:118992342-118992364 ATGAGTGGGGAGCGGGTGGAGGG - Intronic
937977066 2:127588776-127588798 ATGGGTGGTGGGTGGGTGGATGG + Intronic
937977133 2:127589012-127589034 ATGGGTGGTGGGTGGGTGGATGG + Intronic
937977287 2:127589564-127589586 ATGGGTGGTGAGTAGGTGGATGG + Intronic
937977299 2:127589603-127589625 ATGGGTGGTGCGTGGGTGGATGG + Intronic
937977375 2:127589845-127589867 ATGGGTGGTGGGCGGGTGGATGG + Intronic
938232211 2:129670966-129670988 ATGAGTGGGGCTGGGGTTGATGG - Intergenic
938310576 2:130286049-130286071 AGGGGTGGGGAGTGGGAGGATGG + Intergenic
938444352 2:131366318-131366340 AGGGGTGGGGAGTGGGAGGATGG - Intergenic
938566946 2:132527092-132527114 GTGGGTGGGGAGCGAGGGGAAGG - Intronic
938727738 2:134121681-134121703 GTGTGTGGGGTTCGGGTGGATGG + Intronic
939382143 2:141448852-141448874 ATGTGTGAGGATTGGGTGGATGG - Intronic
939385375 2:141489141-141489163 GTGAGTGGGGACTGGGTGGGGGG + Intronic
940284424 2:152019531-152019553 ATGAGTGGGTGGATGGTGGATGG + Intronic
942385876 2:175442245-175442267 GTTGGTGGGGAGCGGGTGAAAGG - Intergenic
942628960 2:177935578-177935600 TTGAGTGTGGAGGGAGTGGAGGG - Intronic
944060073 2:195563163-195563185 CGGGGTGGGGAGCGGGTGGGGGG - Intergenic
944135443 2:196394151-196394173 GTGAGGGGGGAGAGGGGGGAGGG + Intronic
944179460 2:196872731-196872753 AGGAGTTGCGAGAGGGTGGAAGG + Intronic
945946945 2:216003679-216003701 CTGAGTGGGGAGCCTGTGGATGG - Intronic
946530105 2:220561427-220561449 GTGGGTGGGGAGCTGGGGGAGGG + Intergenic
946789675 2:223287723-223287745 GTGAGTGGGGAGCTAGGGGAGGG - Intergenic
947137292 2:226987853-226987875 ATCTGTGGTGAGGGGGTGGAGGG + Intronic
947935780 2:234002218-234002240 AGGAGTGGGCAGAGGGAGGAGGG + Intronic
948069215 2:235106289-235106311 AGGAGTGGGGATTGGTTGGAAGG + Intergenic
948217219 2:236240629-236240651 TTGAGTGGGCAGGGGGAGGAGGG + Intronic
948383547 2:237567684-237567706 ATGTGGGGGAAGGGGGTGGATGG - Intergenic
948447078 2:238041057-238041079 TTGAGGGGGGAGCACGTGGAAGG - Intronic
948481238 2:238251842-238251864 ATGAGTGGGGTGAGGGTGGAGGG + Intronic
948523477 2:238556857-238556879 AGGAGGGAGAAGCGGGTGGAGGG - Intergenic
948927484 2:241108578-241108600 CAGAGGGGGGAGCGGGGGGAGGG + Intronic
1170578474 20:17681538-17681560 AGGGGTGGGGTGCGGGCGGAAGG - Intronic
1170901793 20:20470500-20470522 ATAAGTGGGGAGGGAGTGTAGGG + Intronic
1171011237 20:21510474-21510496 AGGAGTGGGGAGTGGGGAGAAGG + Intergenic
1171037740 20:21729371-21729393 AGGAGCGGGGAGGAGGTGGATGG + Intergenic
1172176191 20:32973178-32973200 ATGAGTGAGGAGTTGGTGGTTGG - Intergenic
1172629018 20:36365972-36365994 ATTGGAGGGGAGAGGGTGGAGGG + Intronic
1172654389 20:36528159-36528181 AGGAGTGCGGGGCGGGGGGAGGG - Exonic
1173683212 20:44902225-44902247 ATGACTGGGGAGAGGCTGAAAGG - Intronic
1173849634 20:46209911-46209933 ATGAGAGGGAAGGGGGTGCAGGG + Intronic
1174203950 20:48826341-48826363 AAAAGTGGCCAGCGGGTGGAGGG - Intronic
1174741252 20:53016251-53016273 ATGAGTGGGGAGGGGAAGGGAGG - Intronic
1175490295 20:59376020-59376042 ATGAGTGGGGAGCTGCTAGCAGG + Intergenic
1175491571 20:59384007-59384029 GTGAGCGGGGAGGAGGTGGAGGG + Intergenic
1175885487 20:62288133-62288155 ATGAGGGTGGAGGGGGTGCAGGG + Intronic
1175901180 20:62360457-62360479 ATGGGTGGTGGGTGGGTGGAGGG + Intronic
1175901190 20:62360484-62360506 ATGGGTGGTGGGTGGGTGGAGGG + Intronic
1175901211 20:62360539-62360561 ATGGGTGGTGGGTGGGTGGAGGG + Intronic
1176032402 20:63019191-63019213 GTGGGTGGCGAGCGGGTGGGCGG - Intergenic
1176032407 20:63019206-63019228 GTGAGTGGCGAGCGGGTGGGTGG - Intergenic
1176111327 20:63412081-63412103 TTGACTCGGGAGCGGGTGGCGGG + Intronic
1176546199 21:8201303-8201325 GTGCGTGGGGAGGGGGTGTAGGG + Intergenic
1176565150 21:8384349-8384371 GTGCGTGGGGAGGGGGTGTAGGG + Intergenic
1176676650 21:9784767-9784789 AAGAGTGGTGAGGAGGTGGAGGG + Intergenic
1176988191 21:15462314-15462336 CTGAGTGGGGAGGGGGTTAATGG - Intergenic
1178059338 21:28834782-28834804 ATGAATGGGGATCTGGTGGTGGG + Intergenic
1178172964 21:30062386-30062408 TTGGGTGGGGAGGGGGTGGAGGG - Intergenic
1178475036 21:32930542-32930564 ATGGATGGGGTGCGGGGGGATGG + Intergenic
1179037667 21:37773445-37773467 ATGAGTAGGGAGCAGAGGGAAGG + Intronic
1179566940 21:42254835-42254857 ATGAATGGGGAGCGAGGGGGAGG + Intronic
1181049158 22:20230607-20230629 ACGGGTGGGGAGCGGGTGGAGGG + Intergenic
1181998716 22:26903252-26903274 ATAAGGCGGGAGCGGGTGGGGGG + Intergenic
1182103750 22:27674534-27674556 AGGAGTGGGGAGAGGGAGGAAGG - Intergenic
1182745216 22:32600531-32600553 ATGAGTAGGTTGTGGGTGGATGG + Intronic
1182885919 22:33774070-33774092 AAGGGTGGGGTGGGGGTGGAGGG + Intronic
1183096348 22:35554454-35554476 CTCAGTGGGGTGGGGGTGGAGGG - Intergenic
1183255039 22:36756623-36756645 AGGAGTGGGGAGTAGGGGGAAGG + Intergenic
1183412011 22:37660368-37660390 ATCATTGGGGTGCGGTTGGAGGG - Intronic
1184175195 22:42785058-42785080 TTGAGGGGGGTGCGGGGGGAAGG + Intergenic
1184341655 22:43889544-43889566 ATTTGTGGGGAGCAGGTGGGTGG + Intronic
1184410561 22:44323632-44323654 ATGGATGGTGAGTGGGTGGATGG - Intergenic
1184479521 22:44738425-44738447 ATGAGAGGCGAGCGCGTGGAAGG - Intronic
1184731251 22:46372289-46372311 ATGGGTGGGGAGCGAGTGGATGG - Intronic
1184731264 22:46372341-46372363 ATGGGTGGGGAGCGAGTGGATGG - Intronic
1185018479 22:48359385-48359407 TTGAGTGGGCGACGGGTGGAGGG - Intergenic
1185130817 22:49037592-49037614 AGGATTGGGGAGCGGGAGGAGGG + Intergenic
1203251071 22_KI270733v1_random:117540-117562 GTGCGTGGGGAGGGGGTGTAGGG + Intergenic
949567076 3:5254912-5254934 ATAAGTGGGAAGCCGCTGGAGGG - Intergenic
950640951 3:14347596-14347618 ATGAGTGGGTAGTGGGTGCAGGG - Intergenic
951098548 3:18659773-18659795 ATTTGTGGGTAGAGGGTGGAAGG + Intergenic
951541171 3:23783416-23783438 ATGAGAAGGCAGCTGGTGGAGGG + Intergenic
953007236 3:38989850-38989872 ATGAGAGGGGGTGGGGTGGACGG - Intergenic
954132492 3:48567666-48567688 ATGAGGGGGCCACGGGTGGACGG - Intronic
954146026 3:48634765-48634787 AGGAGTGTGGAGTGGGTGCAAGG + Intronic
954196073 3:48998003-48998025 TGGAGTGAGGAGGGGGTGGAGGG + Intronic
954346508 3:50004303-50004325 AGGAGAGGGGAGGGGGGGGAGGG - Intronic
955225789 3:57059500-57059522 ATGAGTTGGGGGTGGGGGGAGGG + Intronic
955660271 3:61291466-61291488 GAGAGTGGAGAGTGGGTGGAGGG + Intergenic
956447330 3:69338306-69338328 GTGAGTGGGGAGAGGGGGGAGGG + Intronic
957729059 3:84108409-84108431 TTTAGTGGGGAGAGGGAGGAAGG + Intergenic
959007839 3:101040513-101040535 ATGAGGAGGGAGCTGGTGCAGGG - Intergenic
959264431 3:104119611-104119633 TGGAGTGGGGAGAGGGGGGAGGG - Intergenic
959916643 3:111823870-111823892 ATGTGTGAGGAGATGGTGGAGGG + Intronic
961823033 3:129584970-129584992 AGGGGTGGGGAGCGGGTTGTGGG - Intronic
962190572 3:133306507-133306529 TTGAGTGGGGGGCTGGGGGAGGG - Intronic
962229418 3:133648467-133648489 ATGAGTGGAGAGAGGGAGCAGGG + Intronic
962229555 3:133650359-133650381 GTGTGTGGGGGGCGGGGGGAGGG + Intronic
962691468 3:137902864-137902886 AAGGGTGGGGAGAGGGGGGAGGG + Intergenic
962755475 3:138462617-138462639 AAGGGTGGGGAGTAGGTGGAGGG - Intronic
962937337 3:140092935-140092957 ATGAGGGGTGAGTGGATGGAGGG + Intronic
963327340 3:143877116-143877138 AGGTGTGGGGAGGGGGAGGAGGG - Intergenic
964261770 3:154847606-154847628 ATGAGGGAGGAGTTGGTGGAGGG + Intergenic
966874491 3:184314706-184314728 ATGCGGGGGGAGGGGGTGGGGGG - Intronic
966890857 3:184406516-184406538 GTGAGTGGGGTGCGGGGGGTGGG + Intronic
967795173 3:193592136-193592158 ATGGGTGGGGGGCGGGTAGTGGG + Intronic
967943335 3:194783173-194783195 GTGAGTGGGCAGAGGGTGAAGGG + Intergenic
968594522 4:1475451-1475473 ATGGGTGGGGAATGGATGGATGG + Intergenic
968598652 4:1498580-1498602 ATGAGGGGTGGGCAGGTGGATGG + Intergenic
968605125 4:1531829-1531851 ATGAGTGGGGACTGGGTGTTAGG + Intergenic
968789180 4:2647675-2647697 AGGGGTGGGAAGCGGGGGGAGGG - Intronic
968894349 4:3390024-3390046 AGGAGAAGGGAGCGGGAGGATGG - Intronic
968916647 4:3499669-3499691 ATGAGGGGGGAGAGGGTGTGGGG + Intronic
969214346 4:5710582-5710604 CCTAGTGGGGAGCGGGTGTAAGG + Intergenic
969214354 4:5710622-5710644 CTCAGTGGGGAGTGGGTGTAAGG + Intergenic
969858932 4:10020894-10020916 GTGAGTGGGGAGCGGGTGGAGGG - Intronic
970193095 4:13533499-13533521 GTGGGTGGGGGGCGGGTGGGGGG - Intergenic
970324675 4:14911113-14911135 ATGATTGGGGAGCATGTGGTGGG + Intergenic
971198571 4:24491988-24492010 ATGAGTGGGGACTGGATGGATGG + Intergenic
971198669 4:24492460-24492482 ATGAGTGGGGACTGGATGGATGG + Intergenic
971531840 4:27698470-27698492 TTGGGTGGGGGGAGGGTGGAGGG - Intergenic
973333664 4:48934625-48934647 AGGAGTGGGGTGAGGGTGGCAGG - Intergenic
974255986 4:59456295-59456317 AGGGGTGGGGAGAGGGGGGAGGG - Intergenic
975263762 4:72336842-72336864 GTGGGTGGGGCGGGGGTGGAGGG - Intronic
975713796 4:77186810-77186832 ATGAGTGTGGGGTGGGAGGAGGG - Intronic
975997876 4:80336865-80336887 AAGTGTGGGGAGCTGGTGGCAGG - Intronic
977061244 4:92259311-92259333 TTGGGTGGGGAGCTGGGGGAGGG - Intergenic
978023190 4:103839214-103839236 AGGAGTGGGGAGTGGGGAGAGGG + Intergenic
978596219 4:110379859-110379881 AGGAGTGGGGTGCTGGTGGATGG - Intronic
980099002 4:128522691-128522713 CTGAGTGGGGAATGGGAGGAAGG - Intergenic
981201611 4:141986787-141986809 TGGGGTGGGGAGAGGGTGGAGGG - Intergenic
982181307 4:152751011-152751033 GTGAGTGGGGGGAGGGAGGAGGG + Intronic
983632120 4:169859978-169860000 AGGAGAGGGGAGCGGGGGAAGGG + Intergenic
985125889 4:186693942-186693964 AAGAGTGGGGAGATGGTGGTTGG - Intronic
985398887 4:189574001-189574023 AAGAGTGGTGAGGAGGTGGAGGG - Intergenic
985837272 5:2280621-2280643 ATGGGTGGGTAGGTGGTGGATGG + Intergenic
986020467 5:3796806-3796828 ATGAATTGAGAGTGGGTGGATGG + Intergenic
986026430 5:3855210-3855232 ATGTGTAGGAAGCAGGTGGATGG + Intergenic
986384237 5:7216204-7216226 AAGAGTGGGCATGGGGTGGAGGG + Intergenic
986793065 5:11182082-11182104 ATGTGTGGGGTGTGTGTGGATGG + Intronic
987173318 5:15281471-15281493 GTGAGTGGGGGGTGGGAGGAGGG + Intergenic
987334648 5:16888173-16888195 ATGATTGGGGAGGGGGTGTTAGG - Intronic
989078755 5:37593298-37593320 AGGGGTGGGGAGCAGGGGGAGGG - Intronic
989401350 5:41010868-41010890 ATGTGAGGGGAGCGGGTAGATGG + Intronic
989432311 5:41370093-41370115 ATAAGTGATGAGGGGGTGGAAGG + Intronic
990014230 5:51039447-51039469 GAAAGTGGGGAGGGGGTGGAAGG - Intergenic
990350259 5:54908941-54908963 ATGGGTGGGGTGAGGCTGGAGGG - Intergenic
990970089 5:61496247-61496269 ATGATTGGGCAGTGGGTGGGGGG - Intronic
991550608 5:67831813-67831835 GCGAGTGGGGGGCGGGGGGACGG + Intergenic
992013548 5:72554611-72554633 CTGAGTGGGGAGGGGCAGGAAGG - Intergenic
992489055 5:77223375-77223397 ATGGGTGGGGGGAGGGGGGAGGG - Intronic
992669873 5:79048554-79048576 ATGAGTGGAGAGTGTGTGGCTGG - Intronic
993065601 5:83094332-83094354 AAGAGAGGGGAGCGGAGGGAAGG - Intronic
993686731 5:90946606-90946628 GTGTGTGGGGAGTGGGGGGAGGG - Intronic
994177847 5:96731643-96731665 AGGGGTGGGGAGAGGGGGGAGGG - Intronic
996248699 5:121299616-121299638 ATGAGTTTGGAGAGGGTGGTGGG - Intergenic
996650620 5:125872177-125872199 TTGGGTGGGGAGAGGGGGGAGGG - Intergenic
996777328 5:127146654-127146676 ATGGGTGGGGGGAGGGGGGAGGG + Intergenic
998062943 5:139133370-139133392 ATGTTTGGGGAGCAGGTGGGAGG + Intronic
998218002 5:140252113-140252135 GGGAGTGGGGTGGGGGTGGAGGG - Intronic
999136044 5:149319886-149319908 AAGAGTGGGGAGCTGGCTGAAGG + Intronic
999241133 5:150128058-150128080 ATGTGTGATGAGCGGGAGGAGGG - Intronic
999531650 5:152469605-152469627 AAGTGTGGAGAGAGGGTGGAAGG + Intergenic
999673379 5:153976454-153976476 AAGAGTGAGGAGAGGGAGGATGG - Intergenic
1001046292 5:168374553-168374575 ATGAGTGAGGAGAGGGGAGAAGG + Intronic
1001939352 5:175729599-175729621 AGGAGTGGGGAGCGGTGGGCGGG - Intergenic
1002493936 5:179599268-179599290 CAGAGTGGGCAGCTGGTGGAGGG + Intronic
1002744694 5:181461076-181461098 AGGAGTGGGGAGGAGGAGGAGGG + Intergenic
1003234344 6:4282358-4282380 GTGTGGGGGGAGGGGGTGGATGG + Intergenic
1003513458 6:6800380-6800402 ATGAGTGTGGATAGGGTGGAGGG - Intergenic
1003997597 6:11558603-11558625 AAGAGTGGGGAGTGGGAGGTGGG - Intronic
1004562232 6:16761513-16761535 AGGGGAGGGGAGCGGGAGGAGGG - Intergenic
1004611980 6:17250765-17250787 AAGAGTGGGGTGAGGGTTGAGGG - Intergenic
1005532118 6:26718619-26718641 GGGAGTGGGGAGGGGGTGGAGGG - Intergenic
1005538677 6:26783046-26783068 GGGAGTGGGGAGGGGGTGGAGGG + Intergenic
1006354064 6:33543383-33543405 ATGACTGGGGAGGGGGTTCAGGG + Intergenic
1006359396 6:33578999-33579021 AGGAGTGGGGAGCTGGGTGAGGG - Intronic
1007115626 6:39341190-39341212 GTGGCTGGGGAGAGGGTGGAAGG - Intronic
1007284327 6:40736785-40736807 AAGAGTGGGGATCAGGTGGCCGG + Intergenic
1007409858 6:41655243-41655265 TGGAGTGGGGAGGGGGTGGGGGG - Intergenic
1007720567 6:43882796-43882818 CTGAGTGAGGAGAGGGTGGCAGG - Intergenic
1008413010 6:51205282-51205304 AAGAGGGGGGAGGGAGTGGAAGG - Intergenic
1008623388 6:53293826-53293848 ACTAGTGGGGAGGGTGTGGAGGG - Intronic
1008951192 6:57161482-57161504 TTGAGGGGGGCGGGGGTGGAGGG - Intronic
1009009531 6:57825281-57825303 GGGAGTGGGGAGGGGGTGGAGGG + Intergenic
1010775014 6:79875544-79875566 ATGTGTGGGGTACGGGTGGGAGG - Intergenic
1011241806 6:85279681-85279703 ATGTGTGGGGGGTGGGTGGGTGG - Intergenic
1011796849 6:90964963-90964985 AGGAGTTGGGAGAGTGTGGATGG - Intergenic
1014601266 6:123416316-123416338 ATGAGTGAGGAGCAGGTGGTAGG - Intronic
1014781071 6:125565250-125565272 GGGAGTGGGGAGTGAGTGGAGGG - Intergenic
1015325502 6:131918937-131918959 CAGTGTGGGGAGGGGGTGGATGG - Intergenic
1016400740 6:143677864-143677886 AGGAGGGGGAAGCGGGGGGAGGG - Intronic
1016420815 6:143881077-143881099 ATGAGTGGGAGTGGGGTGGAAGG - Intronic
1016523352 6:144971847-144971869 AGGAGTGGGGGGCTGGAGGAGGG - Intergenic
1016764534 6:147777337-147777359 ATGACAGTGGAGTGGGTGGACGG - Intergenic
1017540235 6:155394229-155394251 GGGAGTGGGGAGGGGGAGGAAGG - Intergenic
1017622945 6:156317693-156317715 ATGAGTGGGATGCCAGTGGAGGG - Intergenic
1017717869 6:157224666-157224688 GTGAGTGGGGAGCGGCTGAGGGG + Intergenic
1017754551 6:157518388-157518410 AGGGGTGGGGGGAGGGTGGAAGG + Intronic
1017926847 6:158917959-158917981 CTGAGTGGGGAATGGGGGGAAGG + Intergenic
1018093914 6:160368129-160368151 ATGAGTGGGGAGGGGCAGGTTGG - Intronic
1018890132 6:167977067-167977089 CTGAGTGGGGGGAGGGAGGAGGG + Intergenic
1019249605 6:170734617-170734639 AGGAGTGGGGAGGAGGAGGAGGG + Intergenic
1019264593 7:106776-106798 AATAGTGGGGGGCGGGTGGAGGG + Intergenic
1019467299 7:1196582-1196604 ATGAAGGGGGGGCGGGTGGGGGG + Intergenic
1019531689 7:1506572-1506594 AGGAGGGGGGAGGGGGAGGAGGG - Intergenic
1019732352 7:2634983-2635005 GTGAGAGGGCAGGGGGTGGAGGG + Intronic
1019875656 7:3808311-3808333 TTGAGTGAGGAGCAGATGGAGGG + Intronic
1021374866 7:19894042-19894064 AGGAGTGGGGGGCTGGGGGAAGG + Intergenic
1021697078 7:23286240-23286262 AGGAGGGGGGAGAGGGGGGAAGG - Intergenic
1022290755 7:29000360-29000382 GTGGGTGGGGTGGGGGTGGAGGG + Intronic
1022608047 7:31835655-31835677 ATGTTGGGGGAGCGGGGGGAGGG - Intronic
1022743786 7:33149023-33149045 ATGAATGGGGAGTGAGTGGGAGG + Intronic
1022786133 7:33639232-33639254 ATGGCTGGGGAGAGGGAGGAGGG + Intergenic
1022792113 7:33699575-33699597 ATGCTTGGGGAGGGGGTGGGTGG - Intergenic
1022850896 7:34260950-34260972 AGGATTGGGGATAGGGTGGAAGG - Intergenic
1023650667 7:42365583-42365605 GGGGGTGGGGAGCGGGGGGAGGG - Intergenic
1025474457 7:60902270-60902292 TGGGGTGGGGAGAGGGTGGAGGG - Intergenic
1025512546 7:61587604-61587626 TGGGGTGGGGAGAGGGTGGAGGG + Intergenic
1026585903 7:71656032-71656054 ATGAATGGAGAGGGGCTGGAGGG - Intronic
1026768045 7:73172763-73172785 CTCAGTTGGGAGGGGGTGGAGGG - Intergenic
1027044510 7:74982473-74982495 CTCAGTTGGGAGGGGGTGGAGGG - Intronic
1027079128 7:75219887-75219909 CTCAGTTGGGAGGGGGTGGAGGG + Intergenic
1027988658 7:85329858-85329880 GTGGGTGGGGGGAGGGTGGAGGG - Intergenic
1029020215 7:97357234-97357256 AGGAGTGGGGGGAAGGTGGAAGG + Intergenic
1029200712 7:98837384-98837406 CTGTGTGGGGAGAGGGTGGCTGG + Intergenic
1029237464 7:99132867-99132889 CTGAGTAGGGAGCTGCTGGAGGG + Intronic
1029388358 7:100258466-100258488 CTCAGTTGGGAGGGGGTGGAGGG + Intronic
1029540323 7:101179058-101179080 GGGAGTGGGGTGCGGGTGGGTGG - Intronic
1030115267 7:106058091-106058113 CTGCGTGGGCAGCAGGTGGAGGG + Intergenic
1030540058 7:110818960-110818982 TTGGGTGGGGGGCGGGGGGAGGG + Intronic
1031571050 7:123359827-123359849 ATGAATGGGGAGAGCGGGGAGGG + Intergenic
1031865971 7:127039546-127039568 ATGAGGAGGGAGCCTGTGGAGGG + Intronic
1032010032 7:128339801-128339823 TGGAGTGGGGAGGGAGTGGAGGG + Intronic
1032437382 7:131911188-131911210 TGGAGTGAAGAGCGGGTGGAAGG - Intergenic
1032464841 7:132137700-132137722 ATGGGTGGGGAGATGGTGGGAGG + Intronic
1032464908 7:132137990-132138012 ATGAGTGGGGGATGGGTGGGAGG + Intronic
1032537644 7:132678103-132678125 ATGAGTGGGGAGGTGGAGGAAGG - Intronic
1032628131 7:133615264-133615286 ATGAGGGGGGAGGAGGAGGAGGG - Intronic
1032963155 7:137063994-137064016 ATCAGTGGCCAGAGGGTGGAGGG + Intergenic
1034295946 7:149972578-149972600 ATGGGTGGAGAGCGGGAGCAGGG - Intergenic
1034810105 7:154124324-154124346 ATGGGTGGAGAGCGGGAGCAGGG + Intronic
1035278879 7:157765116-157765138 ATGGATGGGGAGTGAGTGGATGG - Intronic
1035311085 7:157969500-157969522 ATGAGTGGGGAGCTGGGAGGTGG + Intronic
1035498491 8:73039-73061 AGGAGTGGGGAGGAGGAGGAGGG - Intronic
1035628578 8:1091775-1091797 AGGAGTGGGGAGAGGGTCGGGGG - Intergenic
1038258214 8:25970510-25970532 AAGAGTGGGGAGGGGGTGTTGGG - Intronic
1038340573 8:26682042-26682064 AGGAGTGGGAAGAGGGTGGAGGG - Intergenic
1038379055 8:27075148-27075170 CTGGCTGGGGTGCGGGTGGAAGG - Intergenic
1038512613 8:28153593-28153615 ATGACTGGGGAGCTAATGGAGGG + Intronic
1038608941 8:29041452-29041474 ATTAGTGGGGAGCGCGTGTGAGG + Intronic
1039096999 8:33897186-33897208 TGGGGTGGGGAGCGGGGGGAGGG - Intergenic
1041097301 8:54362271-54362293 AGGAGTGGGGACCAGGTGGGTGG + Intergenic
1041274815 8:56146292-56146314 TTGAGTGGGGGGAGGGCGGAGGG - Intergenic
1043176191 8:77025995-77026017 AGGGGTGGGGAGCGAGGGGAGGG + Intergenic
1043378233 8:79673992-79674014 ATGAGTGGGAGGCAGGGGGAAGG - Intergenic
1043874058 8:85464543-85464565 AGGGGTGGGGTGGGGGTGGAAGG - Intronic
1044432918 8:92129950-92129972 TTGGGTGGGGAGAGGGGGGAGGG - Intergenic
1044497079 8:92899382-92899404 AGTATTGGGGAGGGGGTGGAAGG - Intronic
1044547061 8:93471710-93471732 ATAAGTGGGGGGAGGGGGGAGGG + Intergenic
1044583900 8:93850908-93850930 ATTAGTGGGGAGGGGCTGGTAGG - Intergenic
1045656587 8:104393222-104393244 ATGAGGGTGGAGTGAGTGGAAGG + Intronic
1045708096 8:104950730-104950752 GTGGGTGGGGAGGGGGTGGCAGG - Intronic
1046130103 8:109956117-109956139 CTGAGTGGGGGGAGGGGGGAGGG - Intergenic
1047202960 8:122781840-122781862 GGGAGTGGGGAGTGGGTGGGGGG + Exonic
1048205618 8:132412934-132412956 ATGTGTTGGGAGGTGGTGGATGG - Intronic
1048450329 8:134527845-134527867 ATGTGAGGGGAGGGGGCGGATGG - Intronic
1049320626 8:141994448-141994470 ATGAGTGGATAGTGGGTGGATGG - Intergenic
1049397742 8:142409423-142409445 ATGAATGGGGAGCTTGTGCATGG + Intergenic
1049464396 8:142744378-142744400 ATGAGTGGAGGATGGGTGGATGG + Intergenic
1049474729 8:142791489-142791511 ATGAGTGGGCAGATGGTAGATGG - Intergenic
1051459382 9:17294887-17294909 GGGAGTGGGGAGTGGGGGGAGGG + Intronic
1051641449 9:19228560-19228582 ATTAGTGGGGTGTGGGTGGGTGG + Intergenic
1053047001 9:34927938-34927960 ATGAGTTGGGAGCTGGGGGGAGG + Intergenic
1053329170 9:37188510-37188532 AGGGGTGGGGAGAGGGGGGAGGG - Intronic
1053358294 9:37465340-37465362 GTGGGAGGGGGGCGGGTGGAAGG - Exonic
1053447559 9:38164668-38164690 ATGAGTGGGCGGGGGGTGGGGGG - Intergenic
1054571234 9:66813171-66813193 AAGAGTGGGGAGGGGGTGCTAGG + Intergenic
1054975779 9:71143330-71143352 GAGAGTGGGGAGTGGGAGGAGGG - Intronic
1055018169 9:71641464-71641486 ATGACTGGAGAGGGGGTGGGTGG + Intergenic
1055276002 9:74617077-74617099 TTGCGGGGGGAGCGGGTGGTGGG - Intronic
1055535989 9:77245021-77245043 ATGAGTGAGGGGAGAGTGGAGGG + Intronic
1055607166 9:77982796-77982818 TGGAGTGGGGAGAGGGGGGAGGG + Intronic
1055947388 9:81703818-81703840 ATGAATGGGTAGGGGGTGGGAGG - Intergenic
1055999072 9:82194703-82194725 ATGAATGGGGAGCTGGAGGTGGG - Intergenic
1057008709 9:91583258-91583280 ATGAGTGGGTGGAGGTTGGATGG + Intronic
1057008726 9:91583320-91583342 ATGAGTGGGTGGAGGATGGATGG + Intronic
1057008742 9:91583382-91583404 ATGAGTGGGTGGAGGTTGGATGG + Intronic
1057385406 9:94601973-94601995 ATGAATGGGGAGTGTTTGGAGGG + Intergenic
1057489358 9:95509250-95509272 AGGGGAGGGGAGGGGGTGGAGGG + Intronic
1057706080 9:97396080-97396102 ATCAGTGAGGAGCTGGTTGATGG - Intergenic
1058123470 9:101164923-101164945 ATGAGAGGGGAGGGGGTTGGAGG + Intronic
1058432082 9:104928372-104928394 GTGGGTGGGGTGGGGGTGGAGGG + Intergenic
1058449167 9:105080217-105080239 TAGAATGGGGTGCGGGTGGAGGG - Intergenic
1059102796 9:111485784-111485806 ATGAGTGGGATGAGGGGGGATGG - Intergenic
1059322676 9:113481656-113481678 AGGAGTGGGGACCGGTGGGAAGG - Intronic
1059358193 9:113717808-113717830 CTCAGTGGGGAGAGAGTGGAAGG + Intergenic
1059661954 9:116410344-116410366 AGGAGTGGGTAGGGAGTGGATGG - Intergenic
1059750110 9:117239588-117239610 ATGAATGGGGATGGGATGGAGGG - Intronic
1060250897 9:121986196-121986218 AGCTGTGGGGAGCTGGTGGAGGG - Intronic
1060793971 9:126502620-126502642 ATGCATGGGGAGGGTGTGGATGG + Intronic
1060864401 9:126983687-126983709 ATGAGGGAGGAGAGGGAGGATGG - Intronic
1061015124 9:127976996-127977018 GTGGGTGGGGTACGGGTGGAGGG + Intronic
1061378498 9:130240335-130240357 GTCAGTGGGGACAGGGTGGAAGG - Intergenic
1061411853 9:130426095-130426117 AGGAGTGGGGGGTGGATGGATGG - Intronic
1061950569 9:133933700-133933722 ATGGATGGTGAGTGGGTGGATGG + Intronic
1062234084 9:135499912-135499934 GTGACTGGGGAGCGAGCGGAGGG + Intronic
1062248598 9:135583180-135583202 ATAAGTGGGGATCAGGCGGAGGG - Intergenic
1062370460 9:136236172-136236194 GGGAGTGGGGAGGAGGTGGAGGG - Intronic
1203467476 Un_GL000220v1:100807-100829 GTGCGTGGGGAGGGGGTGTAGGG + Intergenic
1203610505 Un_KI270748v1:91555-91577 AGGAGTGGGGAGGAGGAGGAGGG + Intergenic
1185608514 X:1380612-1380634 ATGAGTGGGGAGGGGGAAGGAGG + Intronic
1186301552 X:8204941-8204963 ATTAGTGGGGAGCAGGGGGTGGG + Intergenic
1186434777 X:9533352-9533374 AAAAGTGGGGAGGGGGAGGAAGG - Intronic
1187407460 X:19016686-19016708 ATGGGTGGGGGGAGGGGGGAGGG - Intronic
1188450718 X:30306259-30306281 TTGGGTGGGGAGAAGGTGGAGGG - Intronic
1191091636 X:56629717-56629739 TGGGGTGGGGAGAGGGTGGAGGG - Intergenic
1191579839 X:62748200-62748222 ATGGGTGGGGGGAGGGGGGAGGG + Intergenic
1191933352 X:66398915-66398937 ATGAGAGGGTAGAGGGTGGGAGG - Intergenic
1192164913 X:68822014-68822036 AGGAGAGGGGAGCAGGAGGAAGG + Intergenic
1192236945 X:69302099-69302121 AGGAGTGGGGACCCTGTGGAGGG - Intergenic
1192261153 X:69506405-69506427 ATGAGTGGGGAGGGGCCGCAGGG + Intronic
1192369563 X:70502046-70502068 GTGAGGGGTGAGGGGGTGGAGGG + Intronic
1192438321 X:71156209-71156231 ATTTGTGGGGGGTGGGTGGAAGG - Intronic
1193579539 X:83247183-83247205 GTGAGTGGGGGGAGGGGGGAGGG + Intergenic
1195522965 X:105851750-105851772 ATGGGAGGGGAGGGGGTTGAAGG + Intronic
1195956371 X:110335247-110335269 ATCAGTGGGCAGAGGGTGGGTGG + Intronic
1196544003 X:116941421-116941443 GTGAGTGGGGGGAGGGAGGAGGG - Intergenic
1197178978 X:123513915-123513937 AATAGTGGGAAGCGGGTGGGAGG - Intergenic
1197710990 X:129667106-129667128 AGGAGAGGGGAGGGGCTGGAGGG + Intergenic
1199435099 X:147804248-147804270 GTGAGTGAGGGGTGGGTGGAAGG + Intergenic
1200002093 X:153067402-153067424 TTGTGTGTGGACCGGGTGGAAGG - Intergenic
1200005640 X:153082623-153082645 TTGTGTGTGGACCGGGTGGAAGG + Intergenic
1200360810 X:155604367-155604389 ATGAATGGGGAGGGGGAGAAGGG - Intronic
1201721676 Y:17105011-17105033 AGGAGTGTGGAGAGGGTTGAGGG - Intergenic
1201789642 Y:17825412-17825434 GTGTGTGTGGAGCGGGTGGGGGG - Intergenic
1201811912 Y:18080577-18080599 GTGTGTGTGGAGCGGGTGGGGGG + Intergenic
1202351293 Y:23995162-23995184 GTGTGTGTGGAGCGGGTGGGGGG - Intergenic
1202519486 Y:25674957-25674979 GTGTGTGTGGAGCGGGTGGGGGG + Intergenic