ID: 937064513

View in Genome Browser
Species Human (GRCh38)
Location 2:119007044-119007066
Sequence CTGGAGTAGTGGAAGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937064513_937064517 4 Left 937064513 2:119007044-119007066 CCTTCTTCCTTCCACTACTCCAG No data
Right 937064517 2:119007071-119007093 CTCCACACTCTTTAAGTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937064513 Original CRISPR CTGGAGTAGTGGAAGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr