ID: 937065068

View in Genome Browser
Species Human (GRCh38)
Location 2:119011599-119011621
Sequence CTGCAGCGACCCCGCGTGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937065068_937065073 3 Left 937065068 2:119011599-119011621 CCCGGCACGCGGGGTCGCTGCAG No data
Right 937065073 2:119011625-119011647 GTGCTCAGCCCTCCAGGAGCCGG No data
937065068_937065082 26 Left 937065068 2:119011599-119011621 CCCGGCACGCGGGGTCGCTGCAG No data
Right 937065082 2:119011648-119011670 CCGGTGTCCGCGCTCGCGGGCGG No data
937065068_937065079 22 Left 937065068 2:119011599-119011621 CCCGGCACGCGGGGTCGCTGCAG No data
Right 937065079 2:119011644-119011666 CCGGCCGGTGTCCGCGCTCGCGG No data
937065068_937065074 7 Left 937065068 2:119011599-119011621 CCCGGCACGCGGGGTCGCTGCAG No data
Right 937065074 2:119011629-119011651 TCAGCCCTCCAGGAGCCGGCCGG No data
937065068_937065071 -3 Left 937065068 2:119011599-119011621 CCCGGCACGCGGGGTCGCTGCAG No data
Right 937065071 2:119011619-119011641 CAGGCCGTGCTCAGCCCTCCAGG No data
937065068_937065080 23 Left 937065068 2:119011599-119011621 CCCGGCACGCGGGGTCGCTGCAG No data
Right 937065080 2:119011645-119011667 CGGCCGGTGTCCGCGCTCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937065068 Original CRISPR CTGCAGCGACCCCGCGTGCC GGG (reversed) Intergenic