ID: 937065069

View in Genome Browser
Species Human (GRCh38)
Location 2:119011600-119011622
Sequence CCTGCAGCGACCCCGCGTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937065069_937065082 25 Left 937065069 2:119011600-119011622 CCGGCACGCGGGGTCGCTGCAGG No data
Right 937065082 2:119011648-119011670 CCGGTGTCCGCGCTCGCGGGCGG No data
937065069_937065073 2 Left 937065069 2:119011600-119011622 CCGGCACGCGGGGTCGCTGCAGG No data
Right 937065073 2:119011625-119011647 GTGCTCAGCCCTCCAGGAGCCGG No data
937065069_937065071 -4 Left 937065069 2:119011600-119011622 CCGGCACGCGGGGTCGCTGCAGG No data
Right 937065071 2:119011619-119011641 CAGGCCGTGCTCAGCCCTCCAGG No data
937065069_937065074 6 Left 937065069 2:119011600-119011622 CCGGCACGCGGGGTCGCTGCAGG No data
Right 937065074 2:119011629-119011651 TCAGCCCTCCAGGAGCCGGCCGG No data
937065069_937065079 21 Left 937065069 2:119011600-119011622 CCGGCACGCGGGGTCGCTGCAGG No data
Right 937065079 2:119011644-119011666 CCGGCCGGTGTCCGCGCTCGCGG No data
937065069_937065080 22 Left 937065069 2:119011600-119011622 CCGGCACGCGGGGTCGCTGCAGG No data
Right 937065080 2:119011645-119011667 CGGCCGGTGTCCGCGCTCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937065069 Original CRISPR CCTGCAGCGACCCCGCGTGC CGG (reversed) Intergenic