ID: 937065072

View in Genome Browser
Species Human (GRCh38)
Location 2:119011623-119011645
Sequence GGCTCCTGGAGGGCTGAGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937065072_937065080 -1 Left 937065072 2:119011623-119011645 CCGTGCTCAGCCCTCCAGGAGCC No data
Right 937065080 2:119011645-119011667 CGGCCGGTGTCCGCGCTCGCGGG No data
937065072_937065086 14 Left 937065072 2:119011623-119011645 CCGTGCTCAGCCCTCCAGGAGCC No data
Right 937065086 2:119011660-119011682 CTCGCGGGCGGCTCTGGGACCGG No data
937065072_937065085 9 Left 937065072 2:119011623-119011645 CCGTGCTCAGCCCTCCAGGAGCC No data
Right 937065085 2:119011655-119011677 CCGCGCTCGCGGGCGGCTCTGGG No data
937065072_937065088 20 Left 937065072 2:119011623-119011645 CCGTGCTCAGCCCTCCAGGAGCC No data
Right 937065088 2:119011666-119011688 GGCGGCTCTGGGACCGGGAGAGG No data
937065072_937065089 26 Left 937065072 2:119011623-119011645 CCGTGCTCAGCCCTCCAGGAGCC No data
Right 937065089 2:119011672-119011694 TCTGGGACCGGGAGAGGCTGCGG No data
937065072_937065082 2 Left 937065072 2:119011623-119011645 CCGTGCTCAGCCCTCCAGGAGCC No data
Right 937065082 2:119011648-119011670 CCGGTGTCCGCGCTCGCGGGCGG No data
937065072_937065087 15 Left 937065072 2:119011623-119011645 CCGTGCTCAGCCCTCCAGGAGCC No data
Right 937065087 2:119011661-119011683 TCGCGGGCGGCTCTGGGACCGGG No data
937065072_937065083 8 Left 937065072 2:119011623-119011645 CCGTGCTCAGCCCTCCAGGAGCC No data
Right 937065083 2:119011654-119011676 TCCGCGCTCGCGGGCGGCTCTGG No data
937065072_937065079 -2 Left 937065072 2:119011623-119011645 CCGTGCTCAGCCCTCCAGGAGCC No data
Right 937065079 2:119011644-119011666 CCGGCCGGTGTCCGCGCTCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937065072 Original CRISPR GGCTCCTGGAGGGCTGAGCA CGG (reversed) Intergenic