ID: 937065075

View in Genome Browser
Species Human (GRCh38)
Location 2:119011633-119011655
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 107}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937065075_937065085 -1 Left 937065075 2:119011633-119011655 CCCTCCAGGAGCCGGCCGGTGTC 0: 1
1: 0
2: 1
3: 13
4: 107
Right 937065085 2:119011655-119011677 CCGCGCTCGCGGGCGGCTCTGGG No data
937065075_937065091 29 Left 937065075 2:119011633-119011655 CCCTCCAGGAGCCGGCCGGTGTC 0: 1
1: 0
2: 1
3: 13
4: 107
Right 937065091 2:119011685-119011707 GAGGCTGCGGCTCCCCGCTAAGG No data
937065075_937065086 4 Left 937065075 2:119011633-119011655 CCCTCCAGGAGCCGGCCGGTGTC 0: 1
1: 0
2: 1
3: 13
4: 107
Right 937065086 2:119011660-119011682 CTCGCGGGCGGCTCTGGGACCGG No data
937065075_937065089 16 Left 937065075 2:119011633-119011655 CCCTCCAGGAGCCGGCCGGTGTC 0: 1
1: 0
2: 1
3: 13
4: 107
Right 937065089 2:119011672-119011694 TCTGGGACCGGGAGAGGCTGCGG No data
937065075_937065083 -2 Left 937065075 2:119011633-119011655 CCCTCCAGGAGCCGGCCGGTGTC 0: 1
1: 0
2: 1
3: 13
4: 107
Right 937065083 2:119011654-119011676 TCCGCGCTCGCGGGCGGCTCTGG No data
937065075_937065087 5 Left 937065075 2:119011633-119011655 CCCTCCAGGAGCCGGCCGGTGTC 0: 1
1: 0
2: 1
3: 13
4: 107
Right 937065087 2:119011661-119011683 TCGCGGGCGGCTCTGGGACCGGG No data
937065075_937065088 10 Left 937065075 2:119011633-119011655 CCCTCCAGGAGCCGGCCGGTGTC 0: 1
1: 0
2: 1
3: 13
4: 107
Right 937065088 2:119011666-119011688 GGCGGCTCTGGGACCGGGAGAGG No data
937065075_937065082 -8 Left 937065075 2:119011633-119011655 CCCTCCAGGAGCCGGCCGGTGTC 0: 1
1: 0
2: 1
3: 13
4: 107
Right 937065082 2:119011648-119011670 CCGGTGTCCGCGCTCGCGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937065075 Original CRISPR GACACCGGCCGGCTCCTGGA GGG (reversed) Intergenic