ID: 937065076

View in Genome Browser
Species Human (GRCh38)
Location 2:119011634-119011656
Sequence GGACACCGGCCGGCTCCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937065076_937065083 -3 Left 937065076 2:119011634-119011656 CCTCCAGGAGCCGGCCGGTGTCC No data
Right 937065083 2:119011654-119011676 TCCGCGCTCGCGGGCGGCTCTGG No data
937065076_937065086 3 Left 937065076 2:119011634-119011656 CCTCCAGGAGCCGGCCGGTGTCC No data
Right 937065086 2:119011660-119011682 CTCGCGGGCGGCTCTGGGACCGG No data
937065076_937065085 -2 Left 937065076 2:119011634-119011656 CCTCCAGGAGCCGGCCGGTGTCC No data
Right 937065085 2:119011655-119011677 CCGCGCTCGCGGGCGGCTCTGGG No data
937065076_937065088 9 Left 937065076 2:119011634-119011656 CCTCCAGGAGCCGGCCGGTGTCC No data
Right 937065088 2:119011666-119011688 GGCGGCTCTGGGACCGGGAGAGG No data
937065076_937065089 15 Left 937065076 2:119011634-119011656 CCTCCAGGAGCCGGCCGGTGTCC No data
Right 937065089 2:119011672-119011694 TCTGGGACCGGGAGAGGCTGCGG No data
937065076_937065091 28 Left 937065076 2:119011634-119011656 CCTCCAGGAGCCGGCCGGTGTCC No data
Right 937065091 2:119011685-119011707 GAGGCTGCGGCTCCCCGCTAAGG No data
937065076_937065087 4 Left 937065076 2:119011634-119011656 CCTCCAGGAGCCGGCCGGTGTCC No data
Right 937065087 2:119011661-119011683 TCGCGGGCGGCTCTGGGACCGGG No data
937065076_937065082 -9 Left 937065076 2:119011634-119011656 CCTCCAGGAGCCGGCCGGTGTCC No data
Right 937065082 2:119011648-119011670 CCGGTGTCCGCGCTCGCGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937065076 Original CRISPR GGACACCGGCCGGCTCCTGG AGG (reversed) Intergenic