ID: 937065077

View in Genome Browser
Species Human (GRCh38)
Location 2:119011637-119011659
Sequence CGCGGACACCGGCCGGCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937065077_937065088 6 Left 937065077 2:119011637-119011659 CCAGGAGCCGGCCGGTGTCCGCG No data
Right 937065088 2:119011666-119011688 GGCGGCTCTGGGACCGGGAGAGG No data
937065077_937065087 1 Left 937065077 2:119011637-119011659 CCAGGAGCCGGCCGGTGTCCGCG No data
Right 937065087 2:119011661-119011683 TCGCGGGCGGCTCTGGGACCGGG No data
937065077_937065083 -6 Left 937065077 2:119011637-119011659 CCAGGAGCCGGCCGGTGTCCGCG No data
Right 937065083 2:119011654-119011676 TCCGCGCTCGCGGGCGGCTCTGG No data
937065077_937065089 12 Left 937065077 2:119011637-119011659 CCAGGAGCCGGCCGGTGTCCGCG No data
Right 937065089 2:119011672-119011694 TCTGGGACCGGGAGAGGCTGCGG No data
937065077_937065086 0 Left 937065077 2:119011637-119011659 CCAGGAGCCGGCCGGTGTCCGCG No data
Right 937065086 2:119011660-119011682 CTCGCGGGCGGCTCTGGGACCGG No data
937065077_937065085 -5 Left 937065077 2:119011637-119011659 CCAGGAGCCGGCCGGTGTCCGCG No data
Right 937065085 2:119011655-119011677 CCGCGCTCGCGGGCGGCTCTGGG No data
937065077_937065091 25 Left 937065077 2:119011637-119011659 CCAGGAGCCGGCCGGTGTCCGCG No data
Right 937065091 2:119011685-119011707 GAGGCTGCGGCTCCCCGCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937065077 Original CRISPR CGCGGACACCGGCCGGCTCC TGG (reversed) Intergenic