ID: 937065078

View in Genome Browser
Species Human (GRCh38)
Location 2:119011644-119011666
Sequence CCGCGAGCGCGGACACCGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937065078_937065086 -7 Left 937065078 2:119011644-119011666 CCGGCCGGTGTCCGCGCTCGCGG No data
Right 937065086 2:119011660-119011682 CTCGCGGGCGGCTCTGGGACCGG No data
937065078_937065092 27 Left 937065078 2:119011644-119011666 CCGGCCGGTGTCCGCGCTCGCGG No data
Right 937065092 2:119011694-119011716 GCTCCCCGCTAAGGCTCCTGCGG No data
937065078_937065091 18 Left 937065078 2:119011644-119011666 CCGGCCGGTGTCCGCGCTCGCGG No data
Right 937065091 2:119011685-119011707 GAGGCTGCGGCTCCCCGCTAAGG No data
937065078_937065088 -1 Left 937065078 2:119011644-119011666 CCGGCCGGTGTCCGCGCTCGCGG No data
Right 937065088 2:119011666-119011688 GGCGGCTCTGGGACCGGGAGAGG No data
937065078_937065089 5 Left 937065078 2:119011644-119011666 CCGGCCGGTGTCCGCGCTCGCGG No data
Right 937065089 2:119011672-119011694 TCTGGGACCGGGAGAGGCTGCGG No data
937065078_937065087 -6 Left 937065078 2:119011644-119011666 CCGGCCGGTGTCCGCGCTCGCGG No data
Right 937065087 2:119011661-119011683 TCGCGGGCGGCTCTGGGACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937065078 Original CRISPR CCGCGAGCGCGGACACCGGC CGG (reversed) Intergenic