ID: 937065080

View in Genome Browser
Species Human (GRCh38)
Location 2:119011645-119011667
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937065072_937065080 -1 Left 937065072 2:119011623-119011645 CCGTGCTCAGCCCTCCAGGAGCC No data
Right 937065080 2:119011645-119011667 CGGCCGGTGTCCGCGCTCGCGGG No data
937065069_937065080 22 Left 937065069 2:119011600-119011622 CCGGCACGCGGGGTCGCTGCAGG No data
Right 937065080 2:119011645-119011667 CGGCCGGTGTCCGCGCTCGCGGG No data
937065068_937065080 23 Left 937065068 2:119011599-119011621 CCCGGCACGCGGGGTCGCTGCAG No data
Right 937065080 2:119011645-119011667 CGGCCGGTGTCCGCGCTCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type