ID: 937065081

View in Genome Browser
Species Human (GRCh38)
Location 2:119011648-119011670
Sequence CCGCCCGCGAGCGCGGACAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937065081_937065095 27 Left 937065081 2:119011648-119011670 CCGGTGTCCGCGCTCGCGGGCGG No data
Right 937065095 2:119011698-119011720 CCCGCTAAGGCTCCTGCGGCCGG No data
937065081_937065088 -5 Left 937065081 2:119011648-119011670 CCGGTGTCCGCGCTCGCGGGCGG No data
Right 937065088 2:119011666-119011688 GGCGGCTCTGGGACCGGGAGAGG No data
937065081_937065091 14 Left 937065081 2:119011648-119011670 CCGGTGTCCGCGCTCGCGGGCGG No data
Right 937065091 2:119011685-119011707 GAGGCTGCGGCTCCCCGCTAAGG No data
937065081_937065087 -10 Left 937065081 2:119011648-119011670 CCGGTGTCCGCGCTCGCGGGCGG No data
Right 937065087 2:119011661-119011683 TCGCGGGCGGCTCTGGGACCGGG No data
937065081_937065092 23 Left 937065081 2:119011648-119011670 CCGGTGTCCGCGCTCGCGGGCGG No data
Right 937065092 2:119011694-119011716 GCTCCCCGCTAAGGCTCCTGCGG No data
937065081_937065089 1 Left 937065081 2:119011648-119011670 CCGGTGTCCGCGCTCGCGGGCGG No data
Right 937065089 2:119011672-119011694 TCTGGGACCGGGAGAGGCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937065081 Original CRISPR CCGCCCGCGAGCGCGGACAC CGG (reversed) Intergenic