ID: 937065082

View in Genome Browser
Species Human (GRCh38)
Location 2:119011648-119011670
Sequence CCGGTGTCCGCGCTCGCGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937065068_937065082 26 Left 937065068 2:119011599-119011621 CCCGGCACGCGGGGTCGCTGCAG No data
Right 937065082 2:119011648-119011670 CCGGTGTCCGCGCTCGCGGGCGG No data
937065072_937065082 2 Left 937065072 2:119011623-119011645 CCGTGCTCAGCCCTCCAGGAGCC No data
Right 937065082 2:119011648-119011670 CCGGTGTCCGCGCTCGCGGGCGG No data
937065069_937065082 25 Left 937065069 2:119011600-119011622 CCGGCACGCGGGGTCGCTGCAGG No data
Right 937065082 2:119011648-119011670 CCGGTGTCCGCGCTCGCGGGCGG No data
937065076_937065082 -9 Left 937065076 2:119011634-119011656 CCTCCAGGAGCCGGCCGGTGTCC No data
Right 937065082 2:119011648-119011670 CCGGTGTCCGCGCTCGCGGGCGG No data
937065075_937065082 -8 Left 937065075 2:119011633-119011655 CCCTCCAGGAGCCGGCCGGTGTC No data
Right 937065082 2:119011648-119011670 CCGGTGTCCGCGCTCGCGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937065082 Original CRISPR CCGGTGTCCGCGCTCGCGGG CGG Intergenic