ID: 937065083

View in Genome Browser
Species Human (GRCh38)
Location 2:119011654-119011676
Sequence TCCGCGCTCGCGGGCGGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937065075_937065083 -2 Left 937065075 2:119011633-119011655 CCCTCCAGGAGCCGGCCGGTGTC No data
Right 937065083 2:119011654-119011676 TCCGCGCTCGCGGGCGGCTCTGG No data
937065077_937065083 -6 Left 937065077 2:119011637-119011659 CCAGGAGCCGGCCGGTGTCCGCG No data
Right 937065083 2:119011654-119011676 TCCGCGCTCGCGGGCGGCTCTGG No data
937065076_937065083 -3 Left 937065076 2:119011634-119011656 CCTCCAGGAGCCGGCCGGTGTCC No data
Right 937065083 2:119011654-119011676 TCCGCGCTCGCGGGCGGCTCTGG No data
937065072_937065083 8 Left 937065072 2:119011623-119011645 CCGTGCTCAGCCCTCCAGGAGCC No data
Right 937065083 2:119011654-119011676 TCCGCGCTCGCGGGCGGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937065083 Original CRISPR TCCGCGCTCGCGGGCGGCTC TGG Intergenic