ID: 937065084

View in Genome Browser
Species Human (GRCh38)
Location 2:119011655-119011677
Sequence CCCAGAGCCGCCCGCGAGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937065084_937065089 -6 Left 937065084 2:119011655-119011677 CCGCGCTCGCGGGCGGCTCTGGG No data
Right 937065089 2:119011672-119011694 TCTGGGACCGGGAGAGGCTGCGG No data
937065084_937065091 7 Left 937065084 2:119011655-119011677 CCGCGCTCGCGGGCGGCTCTGGG No data
Right 937065091 2:119011685-119011707 GAGGCTGCGGCTCCCCGCTAAGG No data
937065084_937065095 20 Left 937065084 2:119011655-119011677 CCGCGCTCGCGGGCGGCTCTGGG No data
Right 937065095 2:119011698-119011720 CCCGCTAAGGCTCCTGCGGCCGG No data
937065084_937065097 30 Left 937065084 2:119011655-119011677 CCGCGCTCGCGGGCGGCTCTGGG No data
Right 937065097 2:119011708-119011730 CTCCTGCGGCCGGCGCCTCCTGG No data
937065084_937065092 16 Left 937065084 2:119011655-119011677 CCGCGCTCGCGGGCGGCTCTGGG No data
Right 937065092 2:119011694-119011716 GCTCCCCGCTAAGGCTCCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937065084 Original CRISPR CCCAGAGCCGCCCGCGAGCG CGG (reversed) Intergenic