ID: 937065086

View in Genome Browser
Species Human (GRCh38)
Location 2:119011660-119011682
Sequence CTCGCGGGCGGCTCTGGGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937065078_937065086 -7 Left 937065078 2:119011644-119011666 CCGGCCGGTGTCCGCGCTCGCGG No data
Right 937065086 2:119011660-119011682 CTCGCGGGCGGCTCTGGGACCGG No data
937065075_937065086 4 Left 937065075 2:119011633-119011655 CCCTCCAGGAGCCGGCCGGTGTC No data
Right 937065086 2:119011660-119011682 CTCGCGGGCGGCTCTGGGACCGG No data
937065076_937065086 3 Left 937065076 2:119011634-119011656 CCTCCAGGAGCCGGCCGGTGTCC No data
Right 937065086 2:119011660-119011682 CTCGCGGGCGGCTCTGGGACCGG No data
937065072_937065086 14 Left 937065072 2:119011623-119011645 CCGTGCTCAGCCCTCCAGGAGCC No data
Right 937065086 2:119011660-119011682 CTCGCGGGCGGCTCTGGGACCGG No data
937065077_937065086 0 Left 937065077 2:119011637-119011659 CCAGGAGCCGGCCGGTGTCCGCG No data
Right 937065086 2:119011660-119011682 CTCGCGGGCGGCTCTGGGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937065086 Original CRISPR CTCGCGGGCGGCTCTGGGAC CGG Intergenic