ID: 937065087

View in Genome Browser
Species Human (GRCh38)
Location 2:119011661-119011683
Sequence TCGCGGGCGGCTCTGGGACC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937065076_937065087 4 Left 937065076 2:119011634-119011656 CCTCCAGGAGCCGGCCGGTGTCC No data
Right 937065087 2:119011661-119011683 TCGCGGGCGGCTCTGGGACCGGG No data
937065075_937065087 5 Left 937065075 2:119011633-119011655 CCCTCCAGGAGCCGGCCGGTGTC No data
Right 937065087 2:119011661-119011683 TCGCGGGCGGCTCTGGGACCGGG No data
937065077_937065087 1 Left 937065077 2:119011637-119011659 CCAGGAGCCGGCCGGTGTCCGCG No data
Right 937065087 2:119011661-119011683 TCGCGGGCGGCTCTGGGACCGGG No data
937065081_937065087 -10 Left 937065081 2:119011648-119011670 CCGGTGTCCGCGCTCGCGGGCGG No data
Right 937065087 2:119011661-119011683 TCGCGGGCGGCTCTGGGACCGGG No data
937065078_937065087 -6 Left 937065078 2:119011644-119011666 CCGGCCGGTGTCCGCGCTCGCGG No data
Right 937065087 2:119011661-119011683 TCGCGGGCGGCTCTGGGACCGGG No data
937065072_937065087 15 Left 937065072 2:119011623-119011645 CCGTGCTCAGCCCTCCAGGAGCC No data
Right 937065087 2:119011661-119011683 TCGCGGGCGGCTCTGGGACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937065087 Original CRISPR TCGCGGGCGGCTCTGGGACC GGG Intergenic