ID: 937065089

View in Genome Browser
Species Human (GRCh38)
Location 2:119011672-119011694
Sequence TCTGGGACCGGGAGAGGCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937065081_937065089 1 Left 937065081 2:119011648-119011670 CCGGTGTCCGCGCTCGCGGGCGG No data
Right 937065089 2:119011672-119011694 TCTGGGACCGGGAGAGGCTGCGG No data
937065075_937065089 16 Left 937065075 2:119011633-119011655 CCCTCCAGGAGCCGGCCGGTGTC No data
Right 937065089 2:119011672-119011694 TCTGGGACCGGGAGAGGCTGCGG No data
937065078_937065089 5 Left 937065078 2:119011644-119011666 CCGGCCGGTGTCCGCGCTCGCGG No data
Right 937065089 2:119011672-119011694 TCTGGGACCGGGAGAGGCTGCGG No data
937065084_937065089 -6 Left 937065084 2:119011655-119011677 CCGCGCTCGCGGGCGGCTCTGGG No data
Right 937065089 2:119011672-119011694 TCTGGGACCGGGAGAGGCTGCGG No data
937065077_937065089 12 Left 937065077 2:119011637-119011659 CCAGGAGCCGGCCGGTGTCCGCG No data
Right 937065089 2:119011672-119011694 TCTGGGACCGGGAGAGGCTGCGG No data
937065072_937065089 26 Left 937065072 2:119011623-119011645 CCGTGCTCAGCCCTCCAGGAGCC No data
Right 937065089 2:119011672-119011694 TCTGGGACCGGGAGAGGCTGCGG No data
937065076_937065089 15 Left 937065076 2:119011634-119011656 CCTCCAGGAGCCGGCCGGTGTCC No data
Right 937065089 2:119011672-119011694 TCTGGGACCGGGAGAGGCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937065089 Original CRISPR TCTGGGACCGGGAGAGGCTG CGG Intergenic