ID: 937065090

View in Genome Browser
Species Human (GRCh38)
Location 2:119011679-119011701
Sequence CGGGGAGCCGCAGCCTCTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937065090_937065095 -4 Left 937065090 2:119011679-119011701 CCGGGAGAGGCTGCGGCTCCCCG No data
Right 937065095 2:119011698-119011720 CCCGCTAAGGCTCCTGCGGCCGG No data
937065090_937065102 25 Left 937065090 2:119011679-119011701 CCGGGAGAGGCTGCGGCTCCCCG No data
Right 937065102 2:119011727-119011749 CTGGACCCACCCACCCACCTCGG No data
937065090_937065097 6 Left 937065090 2:119011679-119011701 CCGGGAGAGGCTGCGGCTCCCCG No data
Right 937065097 2:119011708-119011730 CTCCTGCGGCCGGCGCCTCCTGG No data
937065090_937065092 -8 Left 937065090 2:119011679-119011701 CCGGGAGAGGCTGCGGCTCCCCG No data
Right 937065092 2:119011694-119011716 GCTCCCCGCTAAGGCTCCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937065090 Original CRISPR CGGGGAGCCGCAGCCTCTCC CGG (reversed) Intergenic