ID: 937065091

View in Genome Browser
Species Human (GRCh38)
Location 2:119011685-119011707
Sequence GAGGCTGCGGCTCCCCGCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937065084_937065091 7 Left 937065084 2:119011655-119011677 CCGCGCTCGCGGGCGGCTCTGGG No data
Right 937065091 2:119011685-119011707 GAGGCTGCGGCTCCCCGCTAAGG No data
937065075_937065091 29 Left 937065075 2:119011633-119011655 CCCTCCAGGAGCCGGCCGGTGTC 0: 1
1: 0
2: 1
3: 13
4: 107
Right 937065091 2:119011685-119011707 GAGGCTGCGGCTCCCCGCTAAGG No data
937065078_937065091 18 Left 937065078 2:119011644-119011666 CCGGCCGGTGTCCGCGCTCGCGG No data
Right 937065091 2:119011685-119011707 GAGGCTGCGGCTCCCCGCTAAGG No data
937065081_937065091 14 Left 937065081 2:119011648-119011670 CCGGTGTCCGCGCTCGCGGGCGG No data
Right 937065091 2:119011685-119011707 GAGGCTGCGGCTCCCCGCTAAGG No data
937065076_937065091 28 Left 937065076 2:119011634-119011656 CCTCCAGGAGCCGGCCGGTGTCC No data
Right 937065091 2:119011685-119011707 GAGGCTGCGGCTCCCCGCTAAGG No data
937065077_937065091 25 Left 937065077 2:119011637-119011659 CCAGGAGCCGGCCGGTGTCCGCG No data
Right 937065091 2:119011685-119011707 GAGGCTGCGGCTCCCCGCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937065091 Original CRISPR GAGGCTGCGGCTCCCCGCTA AGG Intergenic