ID: 937065092

View in Genome Browser
Species Human (GRCh38)
Location 2:119011694-119011716
Sequence GCTCCCCGCTAAGGCTCCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937065081_937065092 23 Left 937065081 2:119011648-119011670 CCGGTGTCCGCGCTCGCGGGCGG No data
Right 937065092 2:119011694-119011716 GCTCCCCGCTAAGGCTCCTGCGG No data
937065090_937065092 -8 Left 937065090 2:119011679-119011701 CCGGGAGAGGCTGCGGCTCCCCG No data
Right 937065092 2:119011694-119011716 GCTCCCCGCTAAGGCTCCTGCGG No data
937065078_937065092 27 Left 937065078 2:119011644-119011666 CCGGCCGGTGTCCGCGCTCGCGG No data
Right 937065092 2:119011694-119011716 GCTCCCCGCTAAGGCTCCTGCGG No data
937065084_937065092 16 Left 937065084 2:119011655-119011677 CCGCGCTCGCGGGCGGCTCTGGG No data
Right 937065092 2:119011694-119011716 GCTCCCCGCTAAGGCTCCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937065092 Original CRISPR GCTCCCCGCTAAGGCTCCTG CGG Intergenic