ID: 937065095

View in Genome Browser
Species Human (GRCh38)
Location 2:119011698-119011720
Sequence CCCGCTAAGGCTCCTGCGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937065084_937065095 20 Left 937065084 2:119011655-119011677 CCGCGCTCGCGGGCGGCTCTGGG No data
Right 937065095 2:119011698-119011720 CCCGCTAAGGCTCCTGCGGCCGG No data
937065081_937065095 27 Left 937065081 2:119011648-119011670 CCGGTGTCCGCGCTCGCGGGCGG No data
Right 937065095 2:119011698-119011720 CCCGCTAAGGCTCCTGCGGCCGG No data
937065090_937065095 -4 Left 937065090 2:119011679-119011701 CCGGGAGAGGCTGCGGCTCCCCG No data
Right 937065095 2:119011698-119011720 CCCGCTAAGGCTCCTGCGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937065095 Original CRISPR CCCGCTAAGGCTCCTGCGGC CGG Intergenic