ID: 937065097 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:119011708-119011730 |
Sequence | CTCCTGCGGCCGGCGCCTCC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
937065090_937065097 | 6 | Left | 937065090 | 2:119011679-119011701 | CCGGGAGAGGCTGCGGCTCCCCG | No data | ||
Right | 937065097 | 2:119011708-119011730 | CTCCTGCGGCCGGCGCCTCCTGG | No data | ||||
937065084_937065097 | 30 | Left | 937065084 | 2:119011655-119011677 | CCGCGCTCGCGGGCGGCTCTGGG | No data | ||
Right | 937065097 | 2:119011708-119011730 | CTCCTGCGGCCGGCGCCTCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
937065097 | Original CRISPR | CTCCTGCGGCCGGCGCCTCC TGG | Intergenic | ||