ID: 937065097

View in Genome Browser
Species Human (GRCh38)
Location 2:119011708-119011730
Sequence CTCCTGCGGCCGGCGCCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937065084_937065097 30 Left 937065084 2:119011655-119011677 CCGCGCTCGCGGGCGGCTCTGGG No data
Right 937065097 2:119011708-119011730 CTCCTGCGGCCGGCGCCTCCTGG No data
937065090_937065097 6 Left 937065090 2:119011679-119011701 CCGGGAGAGGCTGCGGCTCCCCG No data
Right 937065097 2:119011708-119011730 CTCCTGCGGCCGGCGCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937065097 Original CRISPR CTCCTGCGGCCGGCGCCTCC TGG Intergenic