ID: 937065098 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:119011710-119011732 |
| Sequence | GTCCAGGAGGCGCCGGCCGC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 937065098_937065102 | -6 | Left | 937065098 | 2:119011710-119011732 | CCTGCGGCCGGCGCCTCCTGGAC | No data | ||
| Right | 937065102 | 2:119011727-119011749 | CTGGACCCACCCACCCACCTCGG | No data | ||||
| 937065098_937065110 | 24 | Left | 937065098 | 2:119011710-119011732 | CCTGCGGCCGGCGCCTCCTGGAC | No data | ||
| Right | 937065110 | 2:119011757-119011779 | ACGCCTCTCTTCAGCTGTACCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 937065098 | Original CRISPR | GTCCAGGAGGCGCCGGCCGC AGG (reversed) | Intergenic | ||