ID: 937065458

View in Genome Browser
Species Human (GRCh38)
Location 2:119013532-119013554
Sequence CCCGGTGGCACTTTATCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937065451_937065458 17 Left 937065451 2:119013492-119013514 CCCCAGGTGGGCTGCATTTACAG No data
Right 937065458 2:119013532-119013554 CCCGGTGGCACTTTATCTCCTGG No data
937065450_937065458 20 Left 937065450 2:119013489-119013511 CCTCCCCAGGTGGGCTGCATTTA No data
Right 937065458 2:119013532-119013554 CCCGGTGGCACTTTATCTCCTGG No data
937065452_937065458 16 Left 937065452 2:119013493-119013515 CCCAGGTGGGCTGCATTTACAGA No data
Right 937065458 2:119013532-119013554 CCCGGTGGCACTTTATCTCCTGG No data
937065449_937065458 23 Left 937065449 2:119013486-119013508 CCTCCTCCCCAGGTGGGCTGCAT No data
Right 937065458 2:119013532-119013554 CCCGGTGGCACTTTATCTCCTGG No data
937065453_937065458 15 Left 937065453 2:119013494-119013516 CCAGGTGGGCTGCATTTACAGAT No data
Right 937065458 2:119013532-119013554 CCCGGTGGCACTTTATCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937065458 Original CRISPR CCCGGTGGCACTTTATCTCC TGG Intergenic
No off target data available for this crispr