ID: 937070825

View in Genome Browser
Species Human (GRCh38)
Location 2:119061799-119061821
Sequence CGCTGGGGGAACTGAAACCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937070816_937070825 23 Left 937070816 2:119061753-119061775 CCTGTGAATGCAACCAAGAGACA No data
Right 937070825 2:119061799-119061821 CGCTGGGGGAACTGAAACCCCGG No data
937070819_937070825 10 Left 937070819 2:119061766-119061788 CCAAGAGACAGGTGGCTGTAAAG No data
Right 937070825 2:119061799-119061821 CGCTGGGGGAACTGAAACCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937070825 Original CRISPR CGCTGGGGGAACTGAAACCC CGG Intergenic
No off target data available for this crispr