ID: 937075748

View in Genome Browser
Species Human (GRCh38)
Location 2:119105143-119105165
Sequence GTGGAGAAGAACAATCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937075748_937075755 12 Left 937075748 2:119105143-119105165 CCCTCCTGATTGTTCTTCTCCAC No data
Right 937075755 2:119105178-119105200 ACTCTTTTCTGCCCATGTGGTGG No data
937075748_937075754 9 Left 937075748 2:119105143-119105165 CCCTCCTGATTGTTCTTCTCCAC No data
Right 937075754 2:119105175-119105197 CCTACTCTTTTCTGCCCATGTGG No data
937075748_937075757 20 Left 937075748 2:119105143-119105165 CCCTCCTGATTGTTCTTCTCCAC No data
Right 937075757 2:119105186-119105208 CTGCCCATGTGGTGGAAAAAGGG No data
937075748_937075756 19 Left 937075748 2:119105143-119105165 CCCTCCTGATTGTTCTTCTCCAC No data
Right 937075756 2:119105185-119105207 TCTGCCCATGTGGTGGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937075748 Original CRISPR GTGGAGAAGAACAATCAGGA GGG (reversed) Intergenic
No off target data available for this crispr