ID: 937077282

View in Genome Browser
Species Human (GRCh38)
Location 2:119116556-119116578
Sequence TGTGCCCTAGAACAGTCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937077282_937077288 26 Left 937077282 2:119116556-119116578 CCACAAGACTGTTCTAGGGCACA No data
Right 937077288 2:119116605-119116627 CACCATGGCACTGGAACAGGTGG No data
937077282_937077287 23 Left 937077282 2:119116556-119116578 CCACAAGACTGTTCTAGGGCACA No data
Right 937077287 2:119116602-119116624 CAGCACCATGGCACTGGAACAGG No data
937077282_937077283 -5 Left 937077282 2:119116556-119116578 CCACAAGACTGTTCTAGGGCACA No data
Right 937077283 2:119116574-119116596 GCACAAGCACCTGTAGCTGTTGG No data
937077282_937077286 17 Left 937077282 2:119116556-119116578 CCACAAGACTGTTCTAGGGCACA No data
Right 937077286 2:119116596-119116618 GTCACTCAGCACCATGGCACTGG No data
937077282_937077285 11 Left 937077282 2:119116556-119116578 CCACAAGACTGTTCTAGGGCACA No data
Right 937077285 2:119116590-119116612 CTGTTGGTCACTCAGCACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937077282 Original CRISPR TGTGCCCTAGAACAGTCTTG TGG (reversed) Intergenic
No off target data available for this crispr