ID: 937077285

View in Genome Browser
Species Human (GRCh38)
Location 2:119116590-119116612
Sequence CTGTTGGTCACTCAGCACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937077278_937077285 20 Left 937077278 2:119116547-119116569 CCATCCATACCACAAGACTGTTC No data
Right 937077285 2:119116590-119116612 CTGTTGGTCACTCAGCACCATGG No data
937077282_937077285 11 Left 937077282 2:119116556-119116578 CCACAAGACTGTTCTAGGGCACA No data
Right 937077285 2:119116590-119116612 CTGTTGGTCACTCAGCACCATGG No data
937077279_937077285 16 Left 937077279 2:119116551-119116573 CCATACCACAAGACTGTTCTAGG No data
Right 937077285 2:119116590-119116612 CTGTTGGTCACTCAGCACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937077285 Original CRISPR CTGTTGGTCACTCAGCACCA TGG Intergenic
No off target data available for this crispr