ID: 937077287

View in Genome Browser
Species Human (GRCh38)
Location 2:119116602-119116624
Sequence CAGCACCATGGCACTGGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937077279_937077287 28 Left 937077279 2:119116551-119116573 CCATACCACAAGACTGTTCTAGG No data
Right 937077287 2:119116602-119116624 CAGCACCATGGCACTGGAACAGG No data
937077282_937077287 23 Left 937077282 2:119116556-119116578 CCACAAGACTGTTCTAGGGCACA No data
Right 937077287 2:119116602-119116624 CAGCACCATGGCACTGGAACAGG No data
937077284_937077287 -4 Left 937077284 2:119116583-119116605 CCTGTAGCTGTTGGTCACTCAGC No data
Right 937077287 2:119116602-119116624 CAGCACCATGGCACTGGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937077287 Original CRISPR CAGCACCATGGCACTGGAAC AGG Intergenic
No off target data available for this crispr