ID: 937077288

View in Genome Browser
Species Human (GRCh38)
Location 2:119116605-119116627
Sequence CACCATGGCACTGGAACAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937077282_937077288 26 Left 937077282 2:119116556-119116578 CCACAAGACTGTTCTAGGGCACA No data
Right 937077288 2:119116605-119116627 CACCATGGCACTGGAACAGGTGG No data
937077284_937077288 -1 Left 937077284 2:119116583-119116605 CCTGTAGCTGTTGGTCACTCAGC No data
Right 937077288 2:119116605-119116627 CACCATGGCACTGGAACAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937077288 Original CRISPR CACCATGGCACTGGAACAGG TGG Intergenic
No off target data available for this crispr