ID: 937080661

View in Genome Browser
Species Human (GRCh38)
Location 2:119137424-119137446
Sequence ATCTATAAGCAAATGGGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937080661_937080668 19 Left 937080661 2:119137424-119137446 CCTCCCCCCATTTGCTTATAGAT No data
Right 937080668 2:119137466-119137488 ATACTTTAAAAAAATCTCCATGG No data
937080661_937080669 27 Left 937080661 2:119137424-119137446 CCTCCCCCCATTTGCTTATAGAT No data
Right 937080669 2:119137474-119137496 AAAAAATCTCCATGGAATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937080661 Original CRISPR ATCTATAAGCAAATGGGGGG AGG (reversed) Intergenic
No off target data available for this crispr