ID: 937080726

View in Genome Browser
Species Human (GRCh38)
Location 2:119137773-119137795
Sequence CAGTGGCCAGAGAGGGCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937080717_937080726 12 Left 937080717 2:119137738-119137760 CCTCCTCCTCGGGTCAGAGCTGC No data
Right 937080726 2:119137773-119137795 CAGTGGCCAGAGAGGGCAGGTGG No data
937080720_937080726 6 Left 937080720 2:119137744-119137766 CCTCGGGTCAGAGCTGCTCAGGT No data
Right 937080726 2:119137773-119137795 CAGTGGCCAGAGAGGGCAGGTGG No data
937080718_937080726 9 Left 937080718 2:119137741-119137763 CCTCCTCGGGTCAGAGCTGCTCA No data
Right 937080726 2:119137773-119137795 CAGTGGCCAGAGAGGGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937080726 Original CRISPR CAGTGGCCAGAGAGGGCAGG TGG Intergenic
No off target data available for this crispr