ID: 937080766

View in Genome Browser
Species Human (GRCh38)
Location 2:119137964-119137986
Sequence CTGGAGGAGGGGAAGTTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937080758_937080766 2 Left 937080758 2:119137939-119137961 CCCTGTGGCTAGCAGGGAGGGTT No data
Right 937080766 2:119137964-119137986 CTGGAGGAGGGGAAGTTTGAAGG No data
937080755_937080766 6 Left 937080755 2:119137935-119137957 CCAGCCCTGTGGCTAGCAGGGAG No data
Right 937080766 2:119137964-119137986 CTGGAGGAGGGGAAGTTTGAAGG No data
937080759_937080766 1 Left 937080759 2:119137940-119137962 CCTGTGGCTAGCAGGGAGGGTTT No data
Right 937080766 2:119137964-119137986 CTGGAGGAGGGGAAGTTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937080766 Original CRISPR CTGGAGGAGGGGAAGTTTGA AGG Intergenic
No off target data available for this crispr