ID: 937081811

View in Genome Browser
Species Human (GRCh38)
Location 2:119145603-119145625
Sequence TGCCTGCCTCTCTTAGAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937081808_937081811 -7 Left 937081808 2:119145587-119145609 CCAGGCGAGAGCCCTATGCCTGC No data
Right 937081811 2:119145603-119145625 TGCCTGCCTCTCTTAGAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937081811 Original CRISPR TGCCTGCCTCTCTTAGAAAG TGG Intergenic
No off target data available for this crispr