ID: 937084097

View in Genome Browser
Species Human (GRCh38)
Location 2:119159064-119159086
Sequence GTGCCCCGCCACTGCGTGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 73}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937084097_937084104 13 Left 937084097 2:119159064-119159086 CCACGCACGCAGTGGCGGGGCAC 0: 1
1: 0
2: 0
3: 4
4: 73
Right 937084104 2:119159100-119159122 CACATGGCCACGAAAGCAGCTGG No data
937084097_937084098 -3 Left 937084097 2:119159064-119159086 CCACGCACGCAGTGGCGGGGCAC 0: 1
1: 0
2: 0
3: 4
4: 73
Right 937084098 2:119159084-119159106 CACGCACAGCCACCCCCACATGG 0: 1
1: 0
2: 2
3: 32
4: 297
937084097_937084106 21 Left 937084097 2:119159064-119159086 CCACGCACGCAGTGGCGGGGCAC 0: 1
1: 0
2: 0
3: 4
4: 73
Right 937084106 2:119159108-119159130 CACGAAAGCAGCTGGAATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937084097 Original CRISPR GTGCCCCGCCACTGCGTGCG TGG (reversed) Intergenic