ID: 937086015

View in Genome Browser
Species Human (GRCh38)
Location 2:119172316-119172338
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937086015_937086016 -1 Left 937086015 2:119172316-119172338 CCATCTCAAAAAAAAAAAAGAGA No data
Right 937086016 2:119172338-119172360 AGAGATGTGTTGCAAGAAATCGG No data
937086015_937086021 21 Left 937086015 2:119172316-119172338 CCATCTCAAAAAAAAAAAAGAGA No data
Right 937086021 2:119172360-119172382 GCTTACGTGACCGTGGGGGCTGG No data
937086015_937086019 16 Left 937086015 2:119172316-119172338 CCATCTCAAAAAAAAAAAAGAGA No data
Right 937086019 2:119172355-119172377 AATCGGCTTACGTGACCGTGGGG No data
937086015_937086020 17 Left 937086015 2:119172316-119172338 CCATCTCAAAAAAAAAAAAGAGA No data
Right 937086020 2:119172356-119172378 ATCGGCTTACGTGACCGTGGGGG No data
937086015_937086018 15 Left 937086015 2:119172316-119172338 CCATCTCAAAAAAAAAAAAGAGA No data
Right 937086018 2:119172354-119172376 AAATCGGCTTACGTGACCGTGGG No data
937086015_937086017 14 Left 937086015 2:119172316-119172338 CCATCTCAAAAAAAAAAAAGAGA No data
Right 937086017 2:119172353-119172375 GAAATCGGCTTACGTGACCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937086015 Original CRISPR TCTCTTTTTTTTTTTTGAGA TGG (reversed) Intergenic