ID: 937086017 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:119172353-119172375 |
Sequence | GAAATCGGCTTACGTGACCG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
937086015_937086017 | 14 | Left | 937086015 | 2:119172316-119172338 | CCATCTCAAAAAAAAAAAAGAGA | No data | ||
Right | 937086017 | 2:119172353-119172375 | GAAATCGGCTTACGTGACCGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
937086017 | Original CRISPR | GAAATCGGCTTACGTGACCG TGG | Intergenic | ||