ID: 937086019

View in Genome Browser
Species Human (GRCh38)
Location 2:119172355-119172377
Sequence AATCGGCTTACGTGACCGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937086015_937086019 16 Left 937086015 2:119172316-119172338 CCATCTCAAAAAAAAAAAAGAGA No data
Right 937086019 2:119172355-119172377 AATCGGCTTACGTGACCGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937086019 Original CRISPR AATCGGCTTACGTGACCGTG GGG Intergenic