ID: 937086021

View in Genome Browser
Species Human (GRCh38)
Location 2:119172360-119172382
Sequence GCTTACGTGACCGTGGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937086015_937086021 21 Left 937086015 2:119172316-119172338 CCATCTCAAAAAAAAAAAAGAGA 0: 224
1: 7238
2: 98366
3: 79641
4: 93271
Right 937086021 2:119172360-119172382 GCTTACGTGACCGTGGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937086021 Original CRISPR GCTTACGTGACCGTGGGGGC TGG Intergenic
No off target data available for this crispr