ID: 937086383

View in Genome Browser
Species Human (GRCh38)
Location 2:119174623-119174645
Sequence GTCCCGGGTAGCATGCCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937086374_937086383 17 Left 937086374 2:119174583-119174605 CCAACTAGACAAAAGCCCCACGT No data
Right 937086383 2:119174623-119174645 GTCCCGGGTAGCATGCCCCCTGG No data
937086375_937086383 2 Left 937086375 2:119174598-119174620 CCCCACGTTGCACAGCCCTTGAG No data
Right 937086383 2:119174623-119174645 GTCCCGGGTAGCATGCCCCCTGG No data
937086377_937086383 0 Left 937086377 2:119174600-119174622 CCACGTTGCACAGCCCTTGAGCC No data
Right 937086383 2:119174623-119174645 GTCCCGGGTAGCATGCCCCCTGG No data
937086376_937086383 1 Left 937086376 2:119174599-119174621 CCCACGTTGCACAGCCCTTGAGC No data
Right 937086383 2:119174623-119174645 GTCCCGGGTAGCATGCCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937086383 Original CRISPR GTCCCGGGTAGCATGCCCCC TGG Intergenic
No off target data available for this crispr