ID: 937090916

View in Genome Browser
Species Human (GRCh38)
Location 2:119205612-119205634
Sequence GGCTGTGTGTGGAAGGCAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937090908_937090916 9 Left 937090908 2:119205580-119205602 CCCTTCCAGGAAGAGGGAGTGGC No data
Right 937090916 2:119205612-119205634 GGCTGTGTGTGGAAGGCAAAGGG No data
937090911_937090916 4 Left 937090911 2:119205585-119205607 CCAGGAAGAGGGAGTGGCTGGAC No data
Right 937090916 2:119205612-119205634 GGCTGTGTGTGGAAGGCAAAGGG No data
937090902_937090916 30 Left 937090902 2:119205559-119205581 CCCAGCACTCTGTCAGTAAGGCC No data
Right 937090916 2:119205612-119205634 GGCTGTGTGTGGAAGGCAAAGGG No data
937090909_937090916 8 Left 937090909 2:119205581-119205603 CCTTCCAGGAAGAGGGAGTGGCT No data
Right 937090916 2:119205612-119205634 GGCTGTGTGTGGAAGGCAAAGGG No data
937090903_937090916 29 Left 937090903 2:119205560-119205582 CCAGCACTCTGTCAGTAAGGCCC No data
Right 937090916 2:119205612-119205634 GGCTGTGTGTGGAAGGCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937090916 Original CRISPR GGCTGTGTGTGGAAGGCAAA GGG Intergenic
No off target data available for this crispr