ID: 937091034

View in Genome Browser
Species Human (GRCh38)
Location 2:119206413-119206435
Sequence TCCTTCTTGAGTGCAGCTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937091032_937091034 18 Left 937091032 2:119206372-119206394 CCATTTAGCAGTGGTGGACATTG No data
Right 937091034 2:119206413-119206435 TCCTTCTTGAGTGCAGCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937091034 Original CRISPR TCCTTCTTGAGTGCAGCTTA TGG Intergenic
No off target data available for this crispr