ID: 937091643

View in Genome Browser
Species Human (GRCh38)
Location 2:119210387-119210409
Sequence TCAACCAAAAGGAGAACTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937091641_937091643 8 Left 937091641 2:119210356-119210378 CCAAACAAAGGCTTAAAAACATG No data
Right 937091643 2:119210387-119210409 TCAACCAAAAGGAGAACTCCTGG No data
937091640_937091643 11 Left 937091640 2:119210353-119210375 CCACCAAACAAAGGCTTAAAAAC No data
Right 937091643 2:119210387-119210409 TCAACCAAAAGGAGAACTCCTGG No data
937091638_937091643 27 Left 937091638 2:119210337-119210359 CCATTTGAAAAATGAACCACCAA No data
Right 937091643 2:119210387-119210409 TCAACCAAAAGGAGAACTCCTGG No data
937091637_937091643 28 Left 937091637 2:119210336-119210358 CCCATTTGAAAAATGAACCACCA No data
Right 937091643 2:119210387-119210409 TCAACCAAAAGGAGAACTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937091643 Original CRISPR TCAACCAAAAGGAGAACTCC TGG Intergenic
No off target data available for this crispr