ID: 937092328

View in Genome Browser
Species Human (GRCh38)
Location 2:119214694-119214716
Sequence CTGTGTGGAGGTAAGGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937092320_937092328 4 Left 937092320 2:119214667-119214689 CCTGCTGAAGCCTGCTGTGAAGA No data
Right 937092328 2:119214694-119214716 CTGTGTGGAGGTAAGGCAGTGGG No data
937092323_937092328 -6 Left 937092323 2:119214677-119214699 CCTGCTGTGAAGAGGGACTGTGT No data
Right 937092328 2:119214694-119214716 CTGTGTGGAGGTAAGGCAGTGGG No data
937092319_937092328 23 Left 937092319 2:119214648-119214670 CCATAGTTGCTTGCTGTCTCCTG No data
Right 937092328 2:119214694-119214716 CTGTGTGGAGGTAAGGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937092328 Original CRISPR CTGTGTGGAGGTAAGGCAGT GGG Intergenic
No off target data available for this crispr