ID: 937093509

View in Genome Browser
Species Human (GRCh38)
Location 2:119222191-119222213
Sequence GTGCTGTCCTTGGGCATTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 111}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937093504_937093509 -5 Left 937093504 2:119222173-119222195 CCCAAGCTCGGTTTCCTTGTGCT 0: 1
1: 0
2: 0
3: 6
4: 99
Right 937093509 2:119222191-119222213 GTGCTGTCCTTGGGCATTAAAGG 0: 1
1: 0
2: 0
3: 9
4: 111
937093505_937093509 -6 Left 937093505 2:119222174-119222196 CCAAGCTCGGTTTCCTTGTGCTG 0: 1
1: 0
2: 0
3: 14
4: 120
Right 937093509 2:119222191-119222213 GTGCTGTCCTTGGGCATTAAAGG 0: 1
1: 0
2: 0
3: 9
4: 111
937093502_937093509 14 Left 937093502 2:119222154-119222176 CCTCTCAGTGTTTGCATTTCCCA 0: 1
1: 0
2: 4
3: 30
4: 283
Right 937093509 2:119222191-119222213 GTGCTGTCCTTGGGCATTAAAGG 0: 1
1: 0
2: 0
3: 9
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937093509 Original CRISPR GTGCTGTCCTTGGGCATTAA AGG Intergenic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
901978652 1:13015843-13015865 GGCCTGTCCTTGGGAATTATAGG + Intronic
902003429 1:13213095-13213117 GGCCTGTCCTTGGGAATTATAGG - Intergenic
902022657 1:13358847-13358869 GGCCTGTCCTTGGGAATTATAGG - Intergenic
902230860 1:15026586-15026608 GTGCTGACCTTGAGCATTTTGGG - Intronic
902709362 1:18228030-18228052 GTCCTGGCCATGGGCATGAAGGG - Intronic
905227784 1:36491090-36491112 GGCCTGTCCTTGGGAATTATAGG + Intergenic
909889435 1:80985288-80985310 GTGCTGTGCTTGGGAAACAAAGG - Intergenic
910251050 1:85200377-85200399 CTGCTGTCCCTGGGAATGAAGGG - Exonic
911401225 1:97377968-97377990 GTACTGTACTGGGGCATGAAAGG + Intronic
913126856 1:115799088-115799110 GAGCTGTTCTTGGTCATTACTGG + Intergenic
916145382 1:161734535-161734557 GGGCTTTCCTTGGGAAGTAATGG - Intergenic
916421423 1:164641212-164641234 GTGTTGTCCTTGGCCATTGGGGG + Intronic
1062771672 10:105834-105856 GTCCTGTCCTTGTGTATTTAAGG - Intergenic
1063530617 10:6827542-6827564 GGCCTGTCCTTGGGAATTATAGG + Intergenic
1068689729 10:59903581-59903603 TTCATGTCCTTGGGCACTAAAGG - Intronic
1070761148 10:79025136-79025158 GAGCTGTCCTTGGGCATCACTGG - Intergenic
1073664827 10:105519199-105519221 GTTCTGTCCTTCTGCATGAAGGG - Intergenic
1073748477 10:106497002-106497024 GAGCTGTCCTTGGTCATTCCTGG + Intergenic
1077752061 11:4983205-4983227 GTGCTGTACTGGGGCATCGATGG + Intronic
1082698766 11:56402172-56402194 CTGCTGGCCCTGGGCAATAAGGG - Intergenic
1083394083 11:62376710-62376732 GGCCTGTCCTTGGGAATTATAGG + Intronic
1084981169 11:72829477-72829499 GAGCTGGCCTTGGGATTTAATGG + Exonic
1089762171 11:120735858-120735880 GAGATGTCCTTGCGCCTTAAGGG - Intronic
1089799761 11:121016113-121016135 GCGCAGTCCTTGGGGGTTAAGGG + Intergenic
1090844310 11:130518149-130518171 AAGCTGTCCTTGGTCATTACCGG + Intergenic
1096312409 12:50532795-50532817 GCGCTGTCCTTGGGCTCTCAGGG + Intronic
1097093066 12:56522784-56522806 GTGCTGTCCTTGGGCACATGGGG + Intronic
1100404578 12:94262424-94262446 GGGCTGCTCTTGGGCATTAGAGG + Intronic
1102358435 12:112260993-112261015 GTGCTGACCTTGATAATTAAAGG + Intronic
1104566569 12:129890313-129890335 GTGCTGTCTTTGGTTATTTACGG + Intronic
1104638201 12:130450823-130450845 GTCCTGTCCTGTGGCATTGATGG - Intronic
1106526897 13:30548853-30548875 GTGCTGGTCTTGGACAGTAAAGG + Intronic
1115812219 14:37121939-37121961 TTGCTGTCTCTGGGCATTAGGGG - Intronic
1120096853 14:80398964-80398986 ATGCTGTCCTTGTTCATTGATGG - Intergenic
1121169175 14:91838447-91838469 GTGCTCTCCTTAGGTATCAAGGG - Intronic
1122960122 14:105090404-105090426 ATGGTGTCCTTGGGCCCTAATGG + Intergenic
1127487442 15:59432404-59432426 GTGCTGTCCTTGGGGAAGACAGG + Intronic
1127916439 15:63459193-63459215 CTGCTGGCCCTGGGCAGTAAGGG + Intergenic
1129750323 15:78058425-78058447 GGCCTCTCCTTGGACATTAATGG - Intronic
1130337720 15:82971739-82971761 GTTCTGTCCTTGCACAGTAAAGG - Intronic
1134386057 16:13773756-13773778 GTGCAGTCCTAGAGCATTACTGG + Intergenic
1137536504 16:49330926-49330948 GTGCTGTTCATGGGCAGTCAGGG + Intergenic
1137567183 16:49540661-49540683 GTCCTGCCCTTGTGCATTCAGGG - Intronic
1138245869 16:55466983-55467005 GTGGGGTCCTTGGGCAGTTAGGG - Intronic
1138321917 16:56121789-56121811 CTGCTGGCTCTGGGCATTAATGG - Intergenic
1141960872 16:87407195-87407217 GTGCTGACTTTGGGCAATAAAGG + Exonic
1146691888 17:34882487-34882509 GGACTGTCCTTAGGCATTAGAGG - Intergenic
1149626174 17:58082681-58082703 CTGCTGTCCTTGCACATTTATGG - Intergenic
1155905407 18:31444707-31444729 GTGCTGTCCGTAGGCATTTGGGG - Intergenic
1156820925 18:41371962-41371984 GTGCTTTTCCTGGGCATTAGAGG - Intergenic
1160975282 19:1789900-1789922 AAGCTGGCCTTGGTCATTAACGG - Exonic
1162041414 19:7973131-7973153 GTGCTGGCCTTGCCCATGAATGG - Intronic
1164154102 19:22578754-22578776 GACCTGTCCTTGGGAATTATAGG - Intergenic
1164800564 19:31072950-31072972 ATGCTTTCATTGGGCTTTAATGG - Intergenic
1165397610 19:35574843-35574865 GGCCTGTCCTTGGGAATTATAGG + Intergenic
1165606538 19:37109993-37110015 GGCCTGTCCTTGGGAATTATAGG + Intronic
1167723854 19:51197983-51198005 GTGATATCCTTGGGCTTTTAGGG - Intergenic
1167916784 19:52746565-52746587 GGCCTGTCCTTGGGAATTATAGG + Intergenic
925978145 2:9155454-9155476 GTGCTGGGCTAGGGCATTAGTGG - Intergenic
927579887 2:24233128-24233150 GTTCTGTCCTTGGGCAATACGGG + Intronic
931747844 2:65306309-65306331 CTGCTGACTTTGGTCATTAATGG + Intergenic
932729206 2:74206181-74206203 TTGCTTTCCTTGAGCAATAATGG + Intronic
936497201 2:113032756-113032778 GCTCTTTCCTTGGTCATTAAGGG - Intronic
937093509 2:119222191-119222213 GTGCTGTCCTTGGGCATTAAAGG + Intergenic
942165081 2:173233754-173233776 GGGCTCTCTTTGGGCCTTAATGG - Intronic
1170107024 20:12762878-12762900 GCGCTCTCCCTGGGCATTGAAGG + Intergenic
1171188193 20:23138428-23138450 GAGCTGTCCCTGGGGATAAAGGG - Intergenic
1174724501 20:52847137-52847159 GTGATGTTCTGGGGCATGAATGG - Intergenic
1175411426 20:58772258-58772280 GTGCTGCCCTGTGGCATTGAGGG + Intergenic
1178899725 21:36589232-36589254 GTGCTGTCCTTGGGGACCAAGGG - Intergenic
1179614618 21:42573872-42573894 CAGCAGTCCTTGGGCATTTAGGG + Intronic
1181495945 22:23287565-23287587 ATGCTGTCCTGGGGCCTTGAGGG + Intronic
1181752962 22:25002494-25002516 GGGCTGCTCTGGGGCATTAATGG + Intronic
1182792511 22:32964797-32964819 GTTCTGTCATGGGGCATCAAGGG - Intronic
1183278949 22:36922143-36922165 GTGCTGGCCATGGGCATGACAGG - Exonic
1183832015 22:40423312-40423334 GGGCTGGCCTTGGGCATTCCAGG - Intronic
1184518274 22:44976641-44976663 GGGCTGTCCTTGGACATACAAGG - Intronic
1184615347 22:45634228-45634250 GTGCTTCCGTTAGGCATTAAGGG - Intergenic
950030658 3:9850749-9850771 GGCCTGTCCTTGGGAATTATAGG + Intronic
950099653 3:10348982-10349004 GTGCTGCCCAAGGACATTAATGG - Intronic
950495468 3:13331511-13331533 GTGCTGTCCATGGGGATTTAGGG - Intronic
951040736 3:17986586-17986608 GTGCTGCCCCTGGGGATTTAAGG + Intronic
955130982 3:56168275-56168297 TTGCTGTCATTGGGTATTACTGG + Intronic
961438016 3:126932648-126932670 GGGCTGTCCTTGTGGCTTAAGGG + Intronic
963203282 3:142606297-142606319 GTTATGTCCTGAGGCATTAAGGG + Intronic
963372783 3:144422817-144422839 AAGCTATTCTTGGGCATTAAAGG - Intergenic
965061043 3:163786417-163786439 ATGCTTTCCTTGGGCAGTGATGG + Intergenic
971487224 4:27172416-27172438 GTGCTGTGTTTAAGCATTAACGG - Intergenic
972290797 4:37687880-37687902 GTGCCCTCCTTGGGCTTCAAAGG - Intergenic
975415551 4:74100076-74100098 GTGCTGTCCCTGGGCAGAAAAGG + Intergenic
976365333 4:84227381-84227403 GTGCTTTCCATGGGCTTCAATGG - Intergenic
979585361 4:122409014-122409036 GTGCTGTCCTTGGACAATTATGG - Intronic
985182331 4:187279064-187279086 GTGCTATTCTTGAGCATTCAAGG + Intergenic
986597729 5:9441090-9441112 GTGCTGTGCATGGTGATTAACGG - Intronic
990056562 5:51587853-51587875 CTGCTGTCCTTGGGGAGTGATGG + Intergenic
994674701 5:102805629-102805651 TTGCTGTCCTTGAGAATCAAAGG + Intronic
995975434 5:118030005-118030027 CTGCTCTCCTTAGTCATTAAGGG - Intergenic
996343333 5:122462512-122462534 GAGCTGTCCATGGGCAAGAAAGG - Intronic
997915271 5:137918387-137918409 GTAATGTCCTTGGGATTTAAAGG - Intronic
1003076872 6:2989788-2989810 GTGCTTTCCTTGGGAAAGAACGG + Intronic
1003085271 6:3055481-3055503 GGCCTGTCCTTGGGAATTATAGG - Intergenic
1005730191 6:28689580-28689602 GGCCTGTCCTTGGGAATTATAGG - Intergenic
1007947757 6:45841208-45841230 TTGCTGTCCTGGGGCAGTAATGG + Intergenic
1013769392 6:113610534-113610556 ATTCTGTCCTTGGGCCATAAAGG - Intergenic
1014450458 6:121576061-121576083 AAGCTGTCCTTGGTCATTACTGG + Intergenic
1016756511 6:147693446-147693468 GTCCTGCCCTGGGGCAATAAGGG + Intronic
1019599251 7:1873289-1873311 GTCCTGTCCTGGGGCCTCAATGG + Intronic
1022596152 7:31714963-31714985 GTGCTGTCCTTTGGCATCTAAGG + Intergenic
1026842699 7:73679374-73679396 GTGGTGTCTTTGGGCTTGAATGG - Intergenic
1032630535 7:133646001-133646023 GTGCTGTCATGGGAAATTAATGG - Intronic
1038098411 8:24342725-24342747 TTGCAGTGCTTGGGCCTTAAGGG + Intronic
1042798982 8:72697077-72697099 ATGCTGTCCTTTGCCATTATTGG + Intronic
1050429096 9:5543656-5543678 ATGCTTTCCTTGGGCCTTAGAGG - Intronic
1053072429 9:35109158-35109180 GTGCCATCCTAGGGCACTAAGGG + Exonic
1058919700 9:109601704-109601726 GTGCTTTCTTTGGACAATAAGGG + Intergenic
1187017883 X:15348563-15348585 GTGCTGTCATTTGGTATAAATGG - Intronic
1195046407 X:101058439-101058461 AAGCTGTCCTTGGCCATTCATGG + Intergenic
1196939264 X:120759681-120759703 GTGCTGTCCTGGGGGATGTAAGG + Intergenic
1198956456 X:142136712-142136734 GTAGAGTCCTTGGGCCTTAAGGG + Intergenic
1200260263 X:154611814-154611836 GGCCTGTCCTTGGGAATTATAGG + Intergenic