ID: 937097492

View in Genome Browser
Species Human (GRCh38)
Location 2:119245246-119245268
Sequence CAGGAGGGACAAAGGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937097477_937097492 28 Left 937097477 2:119245195-119245217 CCCTTTCCCAGCACTCTCACTCT No data
Right 937097492 2:119245246-119245268 CAGGAGGGACAAAGGGTGGAGGG No data
937097479_937097492 22 Left 937097479 2:119245201-119245223 CCCAGCACTCTCACTCTGCCAGT No data
Right 937097492 2:119245246-119245268 CAGGAGGGACAAAGGGTGGAGGG No data
937097484_937097492 -5 Left 937097484 2:119245228-119245250 CCCGAGGAAATCATTCAGCAGGA No data
Right 937097492 2:119245246-119245268 CAGGAGGGACAAAGGGTGGAGGG No data
937097480_937097492 21 Left 937097480 2:119245202-119245224 CCAGCACTCTCACTCTGCCAGTT No data
Right 937097492 2:119245246-119245268 CAGGAGGGACAAAGGGTGGAGGG No data
937097478_937097492 27 Left 937097478 2:119245196-119245218 CCTTTCCCAGCACTCTCACTCTG No data
Right 937097492 2:119245246-119245268 CAGGAGGGACAAAGGGTGGAGGG No data
937097485_937097492 -6 Left 937097485 2:119245229-119245251 CCGAGGAAATCATTCAGCAGGAG No data
Right 937097492 2:119245246-119245268 CAGGAGGGACAAAGGGTGGAGGG No data
937097482_937097492 4 Left 937097482 2:119245219-119245241 CCAGTTTTTCCCGAGGAAATCAT No data
Right 937097492 2:119245246-119245268 CAGGAGGGACAAAGGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937097492 Original CRISPR CAGGAGGGACAAAGGGTGGA GGG Intronic
No off target data available for this crispr