ID: 937098815

View in Genome Browser
Species Human (GRCh38)
Location 2:119253045-119253067
Sequence TTCTCTGGGCAGAGGTACGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937098809_937098815 27 Left 937098809 2:119252995-119253017 CCAGCGAGGAGATGACTTACTCA No data
Right 937098815 2:119253045-119253067 TTCTCTGGGCAGAGGTACGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937098815 Original CRISPR TTCTCTGGGCAGAGGTACGG AGG Intronic
No off target data available for this crispr